Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621705842:

Variant ID: vg0621705842 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21705842
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

AACAGCCGATTTTGGTTAAATCTCGAACAGAAAATCTAGATAACGACATCCCGTAGGAACGGGATGACTTAAAAGGTCTATGTTATTTCCATCAAAACGA[T/C]
TGTACACGCATACGGCACGACTCCTAAAAATGAAGATGAAGATGAAGATTAAGTGTTTCACGTAAAACGAGGTGGTAATAACGTGTGATTAATTGAGTTT

Reverse complement sequence

AAACTCAATTAATCACACGTTATTACCACCTCGTTTTACGTGAAACACTTAATCTTCATCTTCATCTTCATTTTTAGGAGTCGTGCCGTATGCGTGTACA[A/G]
TCGTTTTGATGGAAATAACATAGACCTTTTAAGTCATCCCGTTCCTACGGGATGTCGTTATCTAGATTTTCTGTTCGAGATTTAACCAAAATCGGCTGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	34.80%	0.38%	7.02%	NA
All Indica	2759	67.30%	26.90%	0.25%	5.58%	NA
All Japonica	1512	53.90%	34.10%	0.60%	11.38%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	92.60%	7.10%	0.17%	0.17%	NA
Indica II	465	77.00%	20.90%	0.43%	1.72%	NA
Indica III	913	46.00%	43.80%	0.22%	9.97%	NA
Indica Intermediate	786	67.00%	25.80%	0.25%	6.87%	NA
Temperate Japonica	767	35.60%	47.70%	0.65%	16.04%	NA
Tropical Japonica	504	73.20%	19.40%	0.60%	6.75%	NA
Japonica Intermediate	241	71.80%	21.60%	0.41%	6.22%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	53.30%	37.80%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621705842	T -> C	LOC_Os06g36840.1	upstream_gene_variant ; 2412.0bp to feature; MODIFIER	silent_mutation	Average:43.126; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0621705842	T -> C	LOC_Os06g36850.1	downstream_gene_variant ; 3109.0bp to feature; MODIFIER	silent_mutation	Average:43.126; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0621705842	T -> C	LOC_Os06g36840-LOC_Os06g36850	intergenic_region ; MODIFIER	silent_mutation	Average:43.126; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0621705842	T -> DEL	N	N	silent_mutation	Average:43.126; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621705842	2.88E-06	2.88E-06	mr1513	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705842	NA	7.15E-06	mr1164_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705842	NA	6.24E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705842	NA	5.21E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705842	6.66E-06	6.66E-06	mr1474_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705842	NA	1.63E-17	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705842	NA	3.04E-06	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705842	NA	1.39E-12	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251