\
| Variant ID: vg0621705466 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21705466 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGTGGATTCGATGTGTATTTGTCCTACGTGGCGTATAAGGTTACTCAAATGAGGTGCTTGCACTGCTACTGCCCTAGAGGGTTCGTTTCCAGATAGAAT[C/T]
AAGACCGATACCCTTCCGGTTTTGTATATAAATATGGCATGGCTGGTAGCTCCATGGATGGAGAAGACGATCTTGAGATTCAATGGAATTTTCCGGTGAA
TTCACCGGAAAATTCCATTGAATCTCAAGATCGTCTTCTCCATCCATGGAGCTACCAGCCATGCCATATTTATATACAAAACCGGAAGGGTATCGGTCTT[G/A]
ATTCTATCTGGAAACGAACCCTCTAGGGCAGTAGCAGTGCAAGCACCTCATTTGAGTAACCTTATACGCCACGTAGGACAAATACACATCGAATCCACTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621705466 | C -> T | LOC_Os06g36840.1 | upstream_gene_variant ; 2036.0bp to feature; MODIFIER | silent_mutation | Average:64.715; most accessible tissue: Callus, score: 85.473 | N | N | N | N |
| vg0621705466 | C -> T | LOC_Os06g36850.1 | downstream_gene_variant ; 3485.0bp to feature; MODIFIER | silent_mutation | Average:64.715; most accessible tissue: Callus, score: 85.473 | N | N | N | N |
| vg0621705466 | C -> T | LOC_Os06g36840-LOC_Os06g36850 | intergenic_region ; MODIFIER | silent_mutation | Average:64.715; most accessible tissue: Callus, score: 85.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621705466 | NA | 9.23E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621705466 | NA | 1.10E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621705466 | NA | 4.46E-09 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621705466 | NA | 4.29E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621705466 | NA | 1.41E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621705466 | NA | 8.53E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621705466 | 3.08E-06 | NA | mr1037_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621705466 | 6.89E-07 | 5.33E-07 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621705466 | NA | 1.41E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |