RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0621705457:

Variant ID: vg0621705457 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21705457
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTGGGAGTAGTGGATTCGATGTGTATTTGTCCTACGTGGCGTATAAGGTTACTCAAATGAGGTGCTTGCACTGCTACTGCCCTAGAGGGTTCGTTTCC[A/G]
GATAGAATCAAGACCGATACCCTTCCGGTTTTGTATATAAATATGGCATGGCTGGTAGCTCCATGGATGGAGAAGACGATCTTGAGATTCAATGGAATTT

Reverse complement sequence

AAATTCCATTGAATCTCAAGATCGTCTTCTCCATCCATGGAGCTACCAGCCATGCCATATTTATATACAAAACCGGAAGGGTATCGGTCTTGATTCTATC[T/C]
GGAAACGAACCCTCTAGGGCAGTAGCAGTGCAAGCACCTCATTTGAGTAACCTTATACGCCACGTAGGACAAATACACATCGAATCCACTACTCCCACAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	8.90%	0.21%	0.00%	NA
All Indica	2759	91.50%	8.40%	0.07%	0.00%	NA
All Japonica	1512	87.40%	12.00%	0.53%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	94.80%	4.90%	0.22%	0.00%	NA
Indica III	913	85.10%	14.80%	0.11%	0.00%	NA
Indica Intermediate	786	90.60%	9.40%	0.00%	0.00%	NA
Temperate Japonica	767	82.40%	16.70%	0.91%	0.00%	NA
Tropical Japonica	504	92.10%	7.90%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	5.80%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621705457	A -> G	LOC_Os06g36840.1	upstream_gene_variant ; 2027.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Callus, score: 85.473	N	N	N	N
vg0621705457	A -> G	LOC_Os06g36850.1	downstream_gene_variant ; 3494.0bp to feature; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Callus, score: 85.473	N	N	N	N
vg0621705457	A -> G	LOC_Os06g36840-LOC_Os06g36850	intergenic_region ; MODIFIER	silent_mutation	Average:64.978; most accessible tissue: Callus, score: 85.473	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621705457	NA	3.41E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705457	NA	4.65E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705457	1.38E-06	2.79E-07	mr1829	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705457	2.33E-07	1.00E-07	mr1037_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705457	NA	9.63E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621705457	NA	7.92E-08	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0621705457:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact