Variant ID: vg0621705457 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 21705457 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )
CTGTGGGAGTAGTGGATTCGATGTGTATTTGTCCTACGTGGCGTATAAGGTTACTCAAATGAGGTGCTTGCACTGCTACTGCCCTAGAGGGTTCGTTTCC[A/G]
GATAGAATCAAGACCGATACCCTTCCGGTTTTGTATATAAATATGGCATGGCTGGTAGCTCCATGGATGGAGAAGACGATCTTGAGATTCAATGGAATTT
AAATTCCATTGAATCTCAAGATCGTCTTCTCCATCCATGGAGCTACCAGCCATGCCATATTTATATACAAAACCGGAAGGGTATCGGTCTTGATTCTATC[T/C]
GGAAACGAACCCTCTAGGGCAGTAGCAGTGCAAGCACCTCATTTGAGTAACCTTATACGCCACGTAGGACAAATACACATCGAATCCACTACTCCCACAG
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.90% | 8.90% | 0.21% | 0.00% | NA |
All Indica | 2759 | 91.50% | 8.40% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 87.40% | 12.00% | 0.53% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 94.80% | 4.90% | 0.22% | 0.00% | NA |
Indica III | 913 | 85.10% | 14.80% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 82.40% | 16.70% | 0.91% | 0.00% | NA |
Tropical Japonica | 504 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 93.80% | 5.80% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0621705457 | A -> G | LOC_Os06g36840.1 | upstream_gene_variant ; 2027.0bp to feature; MODIFIER | silent_mutation | Average:64.978; most accessible tissue: Callus, score: 85.473 | N | N | N | N |
vg0621705457 | A -> G | LOC_Os06g36850.1 | downstream_gene_variant ; 3494.0bp to feature; MODIFIER | silent_mutation | Average:64.978; most accessible tissue: Callus, score: 85.473 | N | N | N | N |
vg0621705457 | A -> G | LOC_Os06g36840-LOC_Os06g36850 | intergenic_region ; MODIFIER | silent_mutation | Average:64.978; most accessible tissue: Callus, score: 85.473 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0621705457 | NA | 3.41E-07 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0621705457 | NA | 4.65E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0621705457 | 1.38E-06 | 2.79E-07 | mr1829 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0621705457 | 2.33E-07 | 1.00E-07 | mr1037_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0621705457 | NA | 9.63E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0621705457 | NA | 7.92E-08 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |