\
| Variant ID: vg0621676444 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21676444 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATCCCAAAACATATTAACCTACTACATCAGTTCAAAAGTATAACATCTTTTAACATTCAGGATTTGTCCCAAAATATAATAACTTCTCTACCAATATTT[T/C]
ATTACCAACCAATCAAAACTCTTCACCCATTTACTTTTGCTATCTACATCCACTTCTCAACCAATGACAACCTCTCACTATTTAATTCTACATACTTTCT
AGAAAGTATGTAGAATTAAATAGTGAGAGGTTGTCATTGGTTGAGAAGTGGATGTAGATAGCAAAAGTAAATGGGTGAAGAGTTTTGATTGGTTGGTAAT[A/G]
AAATATTGGTAGAGAAGTTATTATATTTTGGGACAAATCCTGAATGTTAAAAGATGTTATACTTTTGAACTGATGTAGTAGGTTAATATGTTTTGGGATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.90% | 27.90% | 12.23% | 1.99% | NA |
| All Indica | 2759 | 68.40% | 20.70% | 8.48% | 2.43% | NA |
| All Japonica | 1512 | 47.40% | 47.50% | 4.50% | 0.60% | NA |
| Aus | 269 | 1.90% | 3.00% | 89.59% | 5.58% | NA |
| Indica I | 595 | 92.40% | 4.70% | 2.86% | 0.00% | NA |
| Indica II | 465 | 77.60% | 15.10% | 3.44% | 3.87% | NA |
| Indica III | 913 | 50.20% | 34.10% | 11.72% | 4.05% | NA |
| Indica Intermediate | 786 | 65.80% | 20.70% | 11.96% | 1.53% | NA |
| Temperate Japonica | 767 | 24.60% | 73.10% | 1.43% | 0.78% | NA |
| Tropical Japonica | 504 | 72.60% | 17.30% | 9.72% | 0.40% | NA |
| Japonica Intermediate | 241 | 67.20% | 29.00% | 3.32% | 0.41% | NA |
| VI/Aromatic | 96 | 67.70% | 5.20% | 25.00% | 2.08% | NA |
| Intermediate | 90 | 70.00% | 16.70% | 12.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621676444 | T -> C | LOC_Os06g36790.1 | upstream_gene_variant ; 4887.0bp to feature; MODIFIER | silent_mutation | Average:35.181; most accessible tissue: Callus, score: 68.766 | N | N | N | N |
| vg0621676444 | T -> C | LOC_Os06g36800.1 | upstream_gene_variant ; 1099.0bp to feature; MODIFIER | silent_mutation | Average:35.181; most accessible tissue: Callus, score: 68.766 | N | N | N | N |
| vg0621676444 | T -> C | LOC_Os06g36790-LOC_Os06g36800 | intergenic_region ; MODIFIER | silent_mutation | Average:35.181; most accessible tissue: Callus, score: 68.766 | N | N | N | N |
| vg0621676444 | T -> DEL | N | N | silent_mutation | Average:35.181; most accessible tissue: Callus, score: 68.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621676444 | NA | 7.26E-08 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 4.35E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | 2.40E-06 | NA | mr1231 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 4.46E-06 | mr1327 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 1.08E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 5.92E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 1.46E-06 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 1.11E-08 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 8.99E-07 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 2.06E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 7.35E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621676444 | NA | 1.42E-07 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |