Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621676444:

Variant ID: vg0621676444 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21676444
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCCCAAAACATATTAACCTACTACATCAGTTCAAAAGTATAACATCTTTTAACATTCAGGATTTGTCCCAAAATATAATAACTTCTCTACCAATATTT[T/C]
ATTACCAACCAATCAAAACTCTTCACCCATTTACTTTTGCTATCTACATCCACTTCTCAACCAATGACAACCTCTCACTATTTAATTCTACATACTTTCT

Reverse complement sequence

AGAAAGTATGTAGAATTAAATAGTGAGAGGTTGTCATTGGTTGAGAAGTGGATGTAGATAGCAAAAGTAAATGGGTGAAGAGTTTTGATTGGTTGGTAAT[A/G]
AAATATTGGTAGAGAAGTTATTATATTTTGGGACAAATCCTGAATGTTAAAAGATGTTATACTTTTGAACTGATGTAGTAGGTTAATATGTTTTGGGATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	27.90%	12.23%	1.99%	NA
All Indica	2759	68.40%	20.70%	8.48%	2.43%	NA
All Japonica	1512	47.40%	47.50%	4.50%	0.60%	NA
Aus	269	1.90%	3.00%	89.59%	5.58%	NA
Indica I	595	92.40%	4.70%	2.86%	0.00%	NA
Indica II	465	77.60%	15.10%	3.44%	3.87%	NA
Indica III	913	50.20%	34.10%	11.72%	4.05%	NA
Indica Intermediate	786	65.80%	20.70%	11.96%	1.53%	NA
Temperate Japonica	767	24.60%	73.10%	1.43%	0.78%	NA
Tropical Japonica	504	72.60%	17.30%	9.72%	0.40%	NA
Japonica Intermediate	241	67.20%	29.00%	3.32%	0.41%	NA
VI/Aromatic	96	67.70%	5.20%	25.00%	2.08%	NA
Intermediate	90	70.00%	16.70%	12.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621676444	T -> C	LOC_Os06g36790.1	upstream_gene_variant ; 4887.0bp to feature; MODIFIER	silent_mutation	Average:35.181; most accessible tissue: Callus, score: 68.766	N	N	N	N
vg0621676444	T -> C	LOC_Os06g36800.1	upstream_gene_variant ; 1099.0bp to feature; MODIFIER	silent_mutation	Average:35.181; most accessible tissue: Callus, score: 68.766	N	N	N	N
vg0621676444	T -> C	LOC_Os06g36790-LOC_Os06g36800	intergenic_region ; MODIFIER	silent_mutation	Average:35.181; most accessible tissue: Callus, score: 68.766	N	N	N	N
vg0621676444	T -> DEL	N	N	silent_mutation	Average:35.181; most accessible tissue: Callus, score: 68.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621676444	NA	7.26E-08	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	4.35E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	2.40E-06	NA	mr1231	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	4.46E-06	mr1327	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	1.08E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	5.92E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	1.46E-06	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	1.11E-08	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	8.99E-07	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	2.06E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	7.35E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444	NA	1.42E-07	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251