\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621676444:

Variant ID: vg0621676444 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21676444
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCCCAAAACATATTAACCTACTACATCAGTTCAAAAGTATAACATCTTTTAACATTCAGGATTTGTCCCAAAATATAATAACTTCTCTACCAATATTT[T/C]
ATTACCAACCAATCAAAACTCTTCACCCATTTACTTTTGCTATCTACATCCACTTCTCAACCAATGACAACCTCTCACTATTTAATTCTACATACTTTCT

Reverse complement sequence

AGAAAGTATGTAGAATTAAATAGTGAGAGGTTGTCATTGGTTGAGAAGTGGATGTAGATAGCAAAAGTAAATGGGTGAAGAGTTTTGATTGGTTGGTAAT[A/G]
AAATATTGGTAGAGAAGTTATTATATTTTGGGACAAATCCTGAATGTTAAAAGATGTTATACTTTTGAACTGATGTAGTAGGTTAATATGTTTTGGGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 27.90% 12.23% 1.99% NA
All Indica  2759 68.40% 20.70% 8.48% 2.43% NA
All Japonica  1512 47.40% 47.50% 4.50% 0.60% NA
Aus  269 1.90% 3.00% 89.59% 5.58% NA
Indica I  595 92.40% 4.70% 2.86% 0.00% NA
Indica II  465 77.60% 15.10% 3.44% 3.87% NA
Indica III  913 50.20% 34.10% 11.72% 4.05% NA
Indica Intermediate  786 65.80% 20.70% 11.96% 1.53% NA
Temperate Japonica  767 24.60% 73.10% 1.43% 0.78% NA
Tropical Japonica  504 72.60% 17.30% 9.72% 0.40% NA
Japonica Intermediate  241 67.20% 29.00% 3.32% 0.41% NA
VI/Aromatic  96 67.70% 5.20% 25.00% 2.08% NA
Intermediate  90 70.00% 16.70% 12.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621676444 T -> C LOC_Os06g36790.1 upstream_gene_variant ; 4887.0bp to feature; MODIFIER silent_mutation Average:35.181; most accessible tissue: Callus, score: 68.766 N N N N
vg0621676444 T -> C LOC_Os06g36800.1 upstream_gene_variant ; 1099.0bp to feature; MODIFIER silent_mutation Average:35.181; most accessible tissue: Callus, score: 68.766 N N N N
vg0621676444 T -> C LOC_Os06g36790-LOC_Os06g36800 intergenic_region ; MODIFIER silent_mutation Average:35.181; most accessible tissue: Callus, score: 68.766 N N N N
vg0621676444 T -> DEL N N silent_mutation Average:35.181; most accessible tissue: Callus, score: 68.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621676444 NA 7.26E-08 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 4.35E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 2.40E-06 NA mr1231 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 4.46E-06 mr1327 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 1.08E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 5.92E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 1.46E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 1.11E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 8.99E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 2.06E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 7.35E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621676444 NA 1.42E-07 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251