Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621649782:

Variant ID: vg0621649782 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21649782
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.50, A: 0.50, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAATTAACCCTTCTAACAAACGCCTAAAGCTGATTTCATAAAATTGAAAAGTAGGCCCTGTAAAGAAGAAATCTGTTTATTAATCATCCCGATTCCCT[A/G]
TCCCTGCGGACGATAACTCACGCTCGTCCTTAGATCCGCCAATTGGGAACAAGGAGGCCCCCGACTTGTGGAGAGCGAGATTATGGAGATTGTGTTTCCA

Reverse complement sequence

TGGAAACACAATCTCCATAATCTCGCTCTCCACAAGTCGGGGGCCTCCTTGTTCCCAATTGGCGGATCTAAGGACGAGCGTGAGTTATCGTCCGCAGGGA[T/C]
AGGGAATCGGGATGATTAATAAACAGATTTCTTCTTTACAGGGCCTACTTTTCAATTTTATGAAATCAGCTTTAGGCGTTTGTTAGAAGGGTTAATTGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 27.20% 0.17% 0.00% NA
All Indica  2759 69.30% 30.50% 0.18% 0.00% NA
All Japonica  1512 91.50% 8.50% 0.07% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 94.80% 4.90% 0.34% 0.00% NA
Indica II  465 78.30% 21.50% 0.22% 0.00% NA
Indica III  913 49.90% 50.10% 0.00% 0.00% NA
Indica Intermediate  786 67.20% 32.60% 0.25% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 78.60% 21.40% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621649782 A -> G LOC_Os06g36750.1 downstream_gene_variant ; 234.0bp to feature; MODIFIER silent_mutation Average:64.405; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N
vg0621649782 A -> G LOC_Os06g36760.1 downstream_gene_variant ; 4113.0bp to feature; MODIFIER silent_mutation Average:64.405; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N
vg0621649782 A -> G LOC_Os06g36750-LOC_Os06g36760 intergenic_region ; MODIFIER silent_mutation Average:64.405; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0621649782 A G 0.05 0.04 0.03 0.03 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621649782 2.43E-06 NA mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 2.62E-07 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 3.93E-06 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 6.98E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 1.81E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 1.60E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 3.39E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 3.50E-09 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 5.62E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 6.98E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 6.13E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 4.74E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 1.00E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621649782 NA 3.10E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251