\
| Variant ID: vg0621629913 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 21629913 |
| Reference Allele: ATTTTG | Alternative Allele: GTTTTG,A |
| Primary Allele: ATTTTG | Secondary Allele: GTTTTG |
Inferred Ancestral Allele: Not determined.
GCCTTAGGTCCTCCCGGGGGGTCCCTTTTATATCGCAGGTCAACTGGTCTCCAAGTAGGACTCGGAGACATCGGACCCGGCATGATACAATGACGACCCA[ATTTTG/GTTTTG,A]
TCCGAGTAGGACTCCTTCCATCTGTGAACTCCATGATGAATTTCCTTAACGTATGCCGAAAACGTCCGTATACGCGTATGTATACCATATCGATATGTGA
TCACATATCGATATGGTATACATACGCGTATACGGACGTTTTCGGCATACGTTAAGGAAATTCATCATGGAGTTCACAGATGGAAGGAGTCCTACTCGGA[CAAAAT/CAAAAC,T]
TGGGTCGTCATTGTATCATGCCGGGTCCGATGTCTCCGAGTCCTACTTGGAGACCAGTTGACCTGCGATATAAAAGGGACCCCCCGGGAGGACCTAAGGC
| Populations | Population Size | Frequency of ATTTTG(primary allele) | Frequency of GTTTTG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.80% | 25.30% | 2.77% | 0.06% | A: 0.02% |
| All Indica | 2759 | 68.70% | 29.30% | 1.99% | 0.00% | NA |
| All Japonica | 1512 | 94.40% | 5.30% | 0.33% | 0.00% | NA |
| Aus | 269 | 1.10% | 93.70% | 4.83% | 0.00% | A: 0.37% |
| Indica I | 595 | 94.30% | 4.70% | 1.01% | 0.00% | NA |
| Indica II | 465 | 78.70% | 20.00% | 1.29% | 0.00% | NA |
| Indica III | 913 | 49.20% | 48.20% | 2.63% | 0.00% | NA |
| Indica Intermediate | 786 | 66.00% | 31.60% | 2.42% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 3.30% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 38.50% | 53.12% | 3.12% | NA |
| Intermediate | 90 | 72.20% | 20.00% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621629913 | ATTTTG -> A | LOC_Os06g36730.1 | upstream_gene_variant ; 336.0bp to feature; MODIFIER | silent_mutation | Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0621629913 | ATTTTG -> A | LOC_Os06g36730-LOC_Os06g36740 | intergenic_region ; MODIFIER | silent_mutation | Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0621629913 | ATTTTG -> DEL | N | N | silent_mutation | Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0621629913 | ATTTTG -> GTTTTG | LOC_Os06g36730.1 | upstream_gene_variant ; 335.0bp to feature; MODIFIER | silent_mutation | Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0621629913 | ATTTTG -> GTTTTG | LOC_Os06g36730-LOC_Os06g36740 | intergenic_region ; MODIFIER | silent_mutation | Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621629913 | NA | 2.45E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | 4.03E-06 | NA | mr1215 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 1.99E-06 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | 3.64E-06 | NA | mr1319 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 2.68E-06 | mr1319 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 5.44E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 1.13E-07 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 5.41E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 2.70E-08 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 2.55E-07 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 3.74E-16 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 1.96E-09 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 5.98E-18 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621629913 | NA | 6.93E-08 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |