\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621629913:

Variant ID: vg0621629913 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 21629913
Reference Allele: ATTTTGAlternative Allele: GTTTTG,A
Primary Allele: ATTTTGSecondary Allele: GTTTTG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCTTAGGTCCTCCCGGGGGGTCCCTTTTATATCGCAGGTCAACTGGTCTCCAAGTAGGACTCGGAGACATCGGACCCGGCATGATACAATGACGACCCA[ATTTTG/GTTTTG,A]
TCCGAGTAGGACTCCTTCCATCTGTGAACTCCATGATGAATTTCCTTAACGTATGCCGAAAACGTCCGTATACGCGTATGTATACCATATCGATATGTGA

Reverse complement sequence

TCACATATCGATATGGTATACATACGCGTATACGGACGTTTTCGGCATACGTTAAGGAAATTCATCATGGAGTTCACAGATGGAAGGAGTCCTACTCGGA[CAAAAT/CAAAAC,T]
TGGGTCGTCATTGTATCATGCCGGGTCCGATGTCTCCGAGTCCTACTTGGAGACCAGTTGACCTGCGATATAAAAGGGACCCCCCGGGAGGACCTAAGGC

Allele Frequencies:

Populations Population SizeFrequency of ATTTTG(primary allele) Frequency of GTTTTG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 25.30% 2.77% 0.06% A: 0.02%
All Indica  2759 68.70% 29.30% 1.99% 0.00% NA
All Japonica  1512 94.40% 5.30% 0.33% 0.00% NA
Aus  269 1.10% 93.70% 4.83% 0.00% A: 0.37%
Indica I  595 94.30% 4.70% 1.01% 0.00% NA
Indica II  465 78.70% 20.00% 1.29% 0.00% NA
Indica III  913 49.20% 48.20% 2.63% 0.00% NA
Indica Intermediate  786 66.00% 31.60% 2.42% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 85.70% 14.30% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 3.30% 1.66% 0.00% NA
VI/Aromatic  96 5.20% 38.50% 53.12% 3.12% NA
Intermediate  90 72.20% 20.00% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621629913 ATTTTG -> A LOC_Os06g36730.1 upstream_gene_variant ; 336.0bp to feature; MODIFIER silent_mutation Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0621629913 ATTTTG -> A LOC_Os06g36730-LOC_Os06g36740 intergenic_region ; MODIFIER silent_mutation Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0621629913 ATTTTG -> DEL N N silent_mutation Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0621629913 ATTTTG -> GTTTTG LOC_Os06g36730.1 upstream_gene_variant ; 335.0bp to feature; MODIFIER silent_mutation Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0621629913 ATTTTG -> GTTTTG LOC_Os06g36730-LOC_Os06g36740 intergenic_region ; MODIFIER silent_mutation Average:43.464; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621629913 NA 2.45E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 4.03E-06 NA mr1215 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 1.99E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 3.64E-06 NA mr1319 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 2.68E-06 mr1319 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 5.44E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 1.13E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 5.41E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 2.70E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 2.55E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 3.74E-16 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 1.96E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 5.98E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621629913 NA 6.93E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251