Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621535653:

Variant ID: vg0621535653 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21535653
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

AAATAGATGCAACCAATCTTAGACACATAGCTAGGCTACTAGGCTTAATAAGTACCTTACATAGCTAGGGTACGGGACTACTAGTAGCTATTATAGGGAT[T/C]
TGGCATGCACAGCAAGCTAGTAGTACCTCCGGTTTTATTTCCTAGCTAGGCTAGTATCAAAGGCAGGACTTAGCCATGCTAGGTACTAGCTATCTGTCAG

Reverse complement sequence

CTGACAGATAGCTAGTACCTAGCATGGCTAAGTCCTGCCTTTGATACTAGCCTAGCTAGGAAATAAAACCGGAGGTACTACTAGCTTGCTGTGCATGCCA[A/G]
ATCCCTATAATAGCTACTAGTAGTCCCGTACCCTAGCTATGTAAGGTACTTATTAAGCCTAGTAGCCTAGCTATGTGTCTAAGATTGGTTGCATCTATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.30%	41.50%	2.18%	0.00%	NA
All Indica	2759	40.80%	56.60%	2.61%	0.00%	NA
All Japonica	1512	76.20%	21.80%	1.98%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	18.70%	75.30%	6.05%	0.00%	NA
Indica II	465	26.50%	70.30%	3.23%	0.00%	NA
Indica III	913	61.90%	37.70%	0.44%	0.00%	NA
Indica Intermediate	786	41.60%	56.20%	2.16%	0.00%	NA
Temperate Japonica	767	95.30%	3.10%	1.56%	0.00%	NA
Tropical Japonica	504	42.70%	54.60%	2.78%	0.00%	NA
Japonica Intermediate	241	85.50%	12.90%	1.66%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	44.40%	54.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621535653	T -> C	LOC_Os06g36650.1	upstream_gene_variant ; 3045.0bp to feature; MODIFIER	silent_mutation	Average:64.685; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0621535653	T -> C	LOC_Os06g36640.1	downstream_gene_variant ; 3780.0bp to feature; MODIFIER	silent_mutation	Average:64.685; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0621535653	T -> C	LOC_Os06g36640-LOC_Os06g36650	intergenic_region ; MODIFIER	silent_mutation	Average:64.685; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621535653	NA	6.87E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	6.91E-08	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	1.38E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	6.77E-22	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	3.12E-20	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	1.80E-07	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	8.50E-16	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	1.00E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	1.75E-23	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	7.36E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	1.40E-36	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	3.93E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	1.34E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	2.30E-11	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	2.35E-28	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	2.96E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	4.82E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	6.24E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	9.72E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	2.74E-06	1.03E-25	mr1583_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	3.33E-09	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	1.72E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	8.57E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	7.02E-21	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	7.71E-19	mr1850_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	4.77E-09	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	1.15E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653	NA	2.45E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251