\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621535653:

Variant ID: vg0621535653 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21535653
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAGATGCAACCAATCTTAGACACATAGCTAGGCTACTAGGCTTAATAAGTACCTTACATAGCTAGGGTACGGGACTACTAGTAGCTATTATAGGGAT[T/C]
TGGCATGCACAGCAAGCTAGTAGTACCTCCGGTTTTATTTCCTAGCTAGGCTAGTATCAAAGGCAGGACTTAGCCATGCTAGGTACTAGCTATCTGTCAG

Reverse complement sequence

CTGACAGATAGCTAGTACCTAGCATGGCTAAGTCCTGCCTTTGATACTAGCCTAGCTAGGAAATAAAACCGGAGGTACTACTAGCTTGCTGTGCATGCCA[A/G]
ATCCCTATAATAGCTACTAGTAGTCCCGTACCCTAGCTATGTAAGGTACTTATTAAGCCTAGTAGCCTAGCTATGTGTCTAAGATTGGTTGCATCTATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 41.50% 2.18% 0.00% NA
All Indica  2759 40.80% 56.60% 2.61% 0.00% NA
All Japonica  1512 76.20% 21.80% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 18.70% 75.30% 6.05% 0.00% NA
Indica II  465 26.50% 70.30% 3.23% 0.00% NA
Indica III  913 61.90% 37.70% 0.44% 0.00% NA
Indica Intermediate  786 41.60% 56.20% 2.16% 0.00% NA
Temperate Japonica  767 95.30% 3.10% 1.56% 0.00% NA
Tropical Japonica  504 42.70% 54.60% 2.78% 0.00% NA
Japonica Intermediate  241 85.50% 12.90% 1.66% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 44.40% 54.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621535653 T -> C LOC_Os06g36650.1 upstream_gene_variant ; 3045.0bp to feature; MODIFIER silent_mutation Average:64.685; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0621535653 T -> C LOC_Os06g36640.1 downstream_gene_variant ; 3780.0bp to feature; MODIFIER silent_mutation Average:64.685; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0621535653 T -> C LOC_Os06g36640-LOC_Os06g36650 intergenic_region ; MODIFIER silent_mutation Average:64.685; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621535653 NA 6.87E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 6.91E-08 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 1.38E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 6.77E-22 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 3.12E-20 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 1.80E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 8.50E-16 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 1.00E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 1.75E-23 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 7.36E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 1.40E-36 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 3.93E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 1.34E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 2.30E-11 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 2.35E-28 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 2.96E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 4.82E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 6.24E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 9.72E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 2.74E-06 1.03E-25 mr1583_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 3.33E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 1.72E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 8.57E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 7.02E-21 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 7.71E-19 mr1850_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 4.77E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 1.15E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621535653 NA 2.45E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251