\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621488776:

Variant ID: vg0621488776 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21488776
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCCAAATCTCATCAAGCCATCTCCCTCCACCCAAAAGCTGGATTGTGTTTGGTCGTCTCCCTCTCTCCACCACTCCCACCCAACTAGTACCGTTGGAG[A/G]
AGGACCGAATAAGGTTATATCTACGGAGCTCAAAATTCAGAGAAGCAGATAAATAGACACTTAATAGGAATATAAAAATATTTCCCAGTTTTTGATTTTT

Reverse complement sequence

AAAAATCAAAAACTGGGAAATATTTTTATATTCCTATTAAGTGTCTATTTATCTGCTTCTCTGAATTTTGAGCTCCGTAGATATAACCTTATTCGGTCCT[T/C]
CTCCAACGGTACTAGTTGGGTGGGAGTGGTGGAGAGAGGGAGACGACCAAACACAATCCAGCTTTTGGGTGGAGGGAGATGGCTTGATGAGATTTGGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 27.80% 2.24% 3.60% NA
All Indica  2759 78.50% 11.70% 3.70% 6.09% NA
All Japonica  1512 57.70% 42.10% 0.20% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 89.20% 0.80% 9.75% 0.17% NA
Indica II  465 77.60% 15.70% 3.44% 3.23% NA
Indica III  913 68.50% 18.30% 0.11% 13.14% NA
Indica Intermediate  786 82.60% 9.90% 3.44% 4.07% NA
Temperate Japonica  767 47.20% 52.50% 0.26% 0.00% NA
Tropical Japonica  504 77.80% 22.00% 0.20% 0.00% NA
Japonica Intermediate  241 49.40% 50.60% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 80.00% 16.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621488776 A -> G LOC_Os06g36570.1 upstream_gene_variant ; 4259.0bp to feature; MODIFIER silent_mutation Average:84.825; most accessible tissue: Zhenshan97 flower, score: 94.812 N N N N
vg0621488776 A -> G LOC_Os06g36590.1 upstream_gene_variant ; 4358.0bp to feature; MODIFIER silent_mutation Average:84.825; most accessible tissue: Zhenshan97 flower, score: 94.812 N N N N
vg0621488776 A -> G LOC_Os06g36580.1 downstream_gene_variant ; 990.0bp to feature; MODIFIER silent_mutation Average:84.825; most accessible tissue: Zhenshan97 flower, score: 94.812 N N N N
vg0621488776 A -> G LOC_Os06g36570-LOC_Os06g36580 intergenic_region ; MODIFIER silent_mutation Average:84.825; most accessible tissue: Zhenshan97 flower, score: 94.812 N N N N
vg0621488776 A -> DEL N N silent_mutation Average:84.825; most accessible tissue: Zhenshan97 flower, score: 94.812 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0621488776 A G -0.09 -0.13 -0.1 0.0 -0.04 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621488776 NA 8.37E-10 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621488776 4.30E-08 5.60E-09 mr1695 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621488776 NA 1.82E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621488776 NA 9.08E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621488776 NA 3.78E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621488776 2.78E-11 2.41E-12 mr1695_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621488776 NA 1.02E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251