\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621487930:

Variant ID: vg0621487930 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 21487930
Reference Allele: ATTTAlternative Allele: TTTT,ATT,A,AT
Primary Allele: ATTTSecondary Allele: TTTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCACGCTTTTCAAACTGCTAAACGGTGCGTTTTTTATAAAAAAAAGTTTCTATACAAAAGTTACTTAAAAAAATCAAATTAATCCATTTTTGAAAAAA[ATTT/TTTT,ATT,A,AT]
TAGCAAATACTTAATTAATCATGTGCTAATGGACTACTCCGTTTTCCGTGTTTACTGTGCATGCGGGGAAACTGGAGTAGCGAACACACCCTAAGTGGGT

Reverse complement sequence

ACCCACTTAGGGTGTGTTCGCTACTCCAGTTTCCCCGCATGCACAGTAAACACGGAAAACGGAGTAGTCCATTAGCACATGATTAATTAAGTATTTGCTA[AAAT/AAAA,AAT,T,AT]
TTTTTTCAAAAATGGATTAATTTGATTTTTTTAAGTAACTTTTGTATAGAAACTTTTTTTTATAAAAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCGC

Allele Frequencies:

Populations Population SizeFrequency of ATTT(primary allele) Frequency of TTTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 19.40% 1.40% 0.00% ATT: 1.78%; A: 0.15%; AT: 0.02%
All Indica  2759 70.50% 27.30% 0.83% 0.00% ATT: 1.20%; A: 0.25%
All Japonica  1512 87.20% 10.10% 2.31% 0.00% ATT: 0.40%
Aus  269 94.80% 1.90% 1.49% 0.00% ATT: 1.86%
Indica I  595 94.10% 4.70% 0.34% 0.00% ATT: 0.84%
Indica II  465 88.20% 11.00% 0.00% 0.00% ATT: 0.86%
Indica III  913 46.80% 51.20% 0.44% 0.00% ATT: 1.10%; A: 0.55%
Indica Intermediate  786 69.60% 26.20% 2.16% 0.00% ATT: 1.78%; A: 0.25%
Temperate Japonica  767 87.70% 9.40% 2.48% 0.00% ATT: 0.39%
Tropical Japonica  504 92.10% 7.50% 0.40% 0.00% NA
Japonica Intermediate  241 75.50% 17.40% 5.81% 0.00% ATT: 1.24%
VI/Aromatic  96 54.20% 3.10% 1.04% 0.00% ATT: 41.67%
Intermediate  90 87.80% 7.80% 3.33% 0.00% AT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621487930 ATTT -> AT LOC_Os06g36570.1 upstream_gene_variant ; 3415.0bp to feature; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> AT LOC_Os06g36580.1 downstream_gene_variant ; 1834.0bp to feature; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> AT LOC_Os06g36570-LOC_Os06g36580 intergenic_region ; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> A LOC_Os06g36570.1 upstream_gene_variant ; 3414.0bp to feature; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> A LOC_Os06g36580.1 downstream_gene_variant ; 1835.0bp to feature; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> A LOC_Os06g36570-LOC_Os06g36580 intergenic_region ; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> TTTT LOC_Os06g36570.1 upstream_gene_variant ; 3413.0bp to feature; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> TTTT LOC_Os06g36580.1 downstream_gene_variant ; 1836.0bp to feature; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> TTTT LOC_Os06g36570-LOC_Os06g36580 intergenic_region ; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> ATT LOC_Os06g36570.1 upstream_gene_variant ; 3416.0bp to feature; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> ATT LOC_Os06g36580.1 downstream_gene_variant ; 1833.0bp to feature; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0621487930 ATTT -> ATT LOC_Os06g36570-LOC_Os06g36580 intergenic_region ; MODIFIER silent_mutation Average:81.64; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0621487930 ATTT A 0.02 0.27 0.28 -0.03 0.04 0.07
vg0621487930 ATTT AT 0.17 0.39 0.34 0.01 0.07 0.1
vg0621487930 ATTT ATT -0.1 -0.03 0.01 0.0 -0.04 -0.09
vg0621487930 ATTT TTTT -0.02 -0.01 0.0 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621487930 1.63E-06 1.63E-06 mr1389 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621487930 3.22E-06 NA mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621487930 6.67E-06 NA mr1757 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621487930 NA 2.33E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621487930 NA 2.49E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621487930 NA 5.78E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621487930 NA 3.52E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621487930 NA 2.16E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621487930 NA 7.35E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251