\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621485267:

Variant ID: vg0621485267 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21485267
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CGACCCCCAATTGCTCGCCGCGGAGATGGGGAGATTGGGGAGAAGGAGACGCGAGTCCCACTGTATTTTTTTTTACTTTTAATTGGACCGTCACTAACAT[A/G,C]
TGGGTTTCACCATTTTTTTCTCATTTTAAACATCGTGTTAGTTAAAACCACCATCCAAACCGTCTTTGATTTTATTTGCATTGTTTTTGAGAGTTGAGGA

Reverse complement sequence

TCCTCAACTCTCAAAAACAATGCAAATAAAATCAAAGACGGTTTGGATGGTGGTTTTAACTAACACGATGTTTAAAATGAGAAAAAAATGGTGAAACCCA[T/C,G]
ATGTTAGTGACGGTCCAATTAAAAGTAAAAAAAAATACAGTGGGACTCGCGTCTCCTTCTCCCCAATCTCCCCATCTCCGCGGCGAGCAATTGGGGGTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 33.20% 0.23% 0.00% C: 1.61%
All Indica  2759 59.00% 39.70% 0.33% 0.00% C: 0.94%
All Japonica  1512 89.50% 10.10% 0.07% 0.00% C: 0.33%
Aus  269 0.40% 97.80% 0.00% 0.00% C: 1.86%
Indica I  595 93.90% 5.20% 0.00% 0.00% C: 0.84%
Indica II  465 67.70% 31.00% 0.43% 0.00% C: 0.86%
Indica III  913 34.30% 64.80% 0.55% 0.00% C: 0.33%
Indica Intermediate  786 56.20% 41.70% 0.25% 0.00% C: 1.78%
Temperate Japonica  767 95.00% 4.70% 0.00% 0.00% C: 0.26%
Tropical Japonica  504 81.90% 18.10% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 10.80% 0.41% 0.00% C: 1.24%
VI/Aromatic  96 24.00% 34.40% 0.00% 0.00% C: 41.67%
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621485267 A -> C LOC_Os06g36570.1 upstream_gene_variant ; 750.0bp to feature; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> C LOC_Os06g36560.1 downstream_gene_variant ; 2527.0bp to feature; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> C LOC_Os06g36580.1 downstream_gene_variant ; 4499.0bp to feature; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> C LOC_Os06g36560.2 downstream_gene_variant ; 2527.0bp to feature; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> C LOC_Os06g36570-LOC_Os06g36580 intergenic_region ; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> G LOC_Os06g36570.1 upstream_gene_variant ; 750.0bp to feature; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> G LOC_Os06g36560.1 downstream_gene_variant ; 2527.0bp to feature; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> G LOC_Os06g36580.1 downstream_gene_variant ; 4499.0bp to feature; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> G LOC_Os06g36560.2 downstream_gene_variant ; 2527.0bp to feature; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N
vg0621485267 A -> G LOC_Os06g36570-LOC_Os06g36580 intergenic_region ; MODIFIER silent_mutation Average:92.745; most accessible tissue: Zhenshan97 flower, score: 96.199 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0621485267 A C -0.03 -0.02 -0.02 -0.03 -0.03 -0.02
vg0621485267 A G -0.01 -0.01 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621485267 NA 7.16E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621485267 NA 1.23E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621485267 5.41E-06 5.42E-06 mr1171_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621485267 NA 5.19E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621485267 NA 1.20E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621485267 3.19E-06 3.22E-08 mr1842_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621485267 NA 4.51E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621485267 NA 5.82E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251