\
| Variant ID: vg0621415154 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21415154 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.11, others allele: 0.00, population size: 254. )
CTCTCCTTTTTCTTTTTCTGTCTCTCCCTTTTGCTTTGCTTCAATATCATCTTTGTCTCTTTAGACATGTAAATTTGAGCACTCAAATGAAACTTCCATC[C/T]
CGTTATCCAGACACATTGGGTGAAGAGAAAGATGAAGTAGGAGGAGGAGGAGGAAGAGAGAGATAGAGGGAGAAGGGGGGGATAAAAGTTAGGGGGTTGG
CCAACCCCCTAACTTTTATCCCCCCCTTCTCCCTCTATCTCTCTCTTCCTCCTCCTCCTCCTACTTCATCTTTCTCTTCACCCAATGTGTCTGGATAACG[G/A]
GATGGAAGTTTCATTTGAGTGCTCAAATTTACATGTCTAAAGAGACAAAGATGATATTGAAGCAAAGCAAAAGGGAGAGACAGAAAAAGAAAAAGGAGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 32.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.50% | 90.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 15.70% | 84.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621415154 | C -> T | LOC_Os06g36470.1 | downstream_gene_variant ; 4831.0bp to feature; MODIFIER | silent_mutation | Average:65.088; most accessible tissue: Callus, score: 90.529 | N | N | N | N |
| vg0621415154 | C -> T | LOC_Os06g36480.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.088; most accessible tissue: Callus, score: 90.529 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621415154 | NA | 1.16E-16 | mr1010 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | 5.70E-07 | 6.15E-08 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 7.90E-24 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 6.03E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 4.93E-23 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 1.30E-20 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 6.13E-15 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 4.81E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 1.39E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 1.65E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 2.86E-18 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | 2.07E-06 | NA | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621415154 | NA | 4.98E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |