\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621398092:

Variant ID: vg0621398092 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21398092
Reference Allele: CAlternative Allele: A,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, A: 0.16, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCAGCGAGACCAGCCAGATCTCAAGACGGCGCGCCGACGATGACGAGGCAGCGGCGGCGGCGCAGCCGCAGAAGGTGGAGCGGCTGTGGATGACGATG[C/A,T]
TGCCGTGCTGGGAGTCGTGGGCGGTGTACGCGCGGCAGGAGGTGGTGCTCCCCGGCGTGGCGCTCGCGTTCCTCTACTTCACCGTGCTGAGCTTCGGGAC

Reverse complement sequence

GTCCCGAAGCTCAGCACGGTGAAGTAGAGGAACGCGAGCGCCACGCCGGGGAGCACCACCTCCTGCCGCGCGTACACCGCCCACGACTCCCAGCACGGCA[G/T,A]
CATCGTCATCCACAGCCGCTCCACCTTCTGCGGCTGCGCCGCCGCCGCTGCCTCGTCATCGTCGGCGCGCCGTCTTGAGATCTGGCTGGTCTCGCTGAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 45.00% 0.04% 0.00% NA
All Indica  2759 90.30% 9.70% 0.00% 0.00% NA
All Japonica  1512 4.10% 95.80% 0.07% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 86.00% 14.00% 0.00% 0.00% NA
Indica Intermediate  786 87.80% 12.20% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 8.10% 91.70% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621398092 C -> T LOC_Os06g36450.1 synonymous_variant ; p.Leu265Leu; LOW N Average:86.26; most accessible tissue: Zhenshan97 panicle, score: 94.278 N N N N
vg0621398092 C -> T LOC_Os06g36440.1 upstream_gene_variant ; 3430.0bp to feature; MODIFIER N Average:86.26; most accessible tissue: Zhenshan97 panicle, score: 94.278 N N N N
vg0621398092 C -> T LOC_Os06g36460.1 upstream_gene_variant ; 2744.0bp to feature; MODIFIER N Average:86.26; most accessible tissue: Zhenshan97 panicle, score: 94.278 N N N N
vg0621398092 C -> A LOC_Os06g36450.1 missense_variant ; p.Leu265Met; MODERATE nonsynonymous_codon ; L265M Average:86.26; most accessible tissue: Zhenshan97 panicle, score: 94.278 unknown unknown TOLERATED 0.13

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0621398092 C A -0.01 0.0 -0.01 -0.01 -0.01 0.0
vg0621398092 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621398092 NA 6.41E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 9.55E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 5.05E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.31E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 6.50E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 6.79E-37 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 4.77E-35 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 8.67E-50 mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 4.59E-44 mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.93E-45 mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 2.20E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 7.21E-30 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 3.89E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 4.63E-27 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.99E-64 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.02E-80 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 7.32E-06 NA mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 2.12E-06 2.70E-06 mr1031_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.42E-30 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 3.60E-63 mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 2.34E-48 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.99E-45 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.08E-37 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 4.01E-62 mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 4.33E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.67E-35 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 1.92E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 6.00E-63 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621398092 NA 8.22E-98 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251