\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621396998:

Variant ID: vg0621396998 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21396998
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTAAAATTCTCTCTCGATATTTACTACTATTTGAGAGACAGAGTAGGTTAGCTGCTGCCTCTGTCAGGTAGTAAACCGGAGGTAGCACAAGAGCAGC[G/A]
TCTCCCTGACTGCTCAGATGCAGACGTGTTCTTGTCTCACCCTTCACCTGCATGATCCTCTCTTTTTCAATCCCTCGATCCACTCATCTCTCCTGGCTAA

Reverse complement sequence

TTAGCCAGGAGAGATGAGTGGATCGAGGGATTGAAAAAGAGAGGATCATGCAGGTGAAGGGTGAGACAAGAACACGTCTGCATCTGAGCAGTCAGGGAGA[C/T]
GCTGCTCTTGTGCTACCTCCGGTTTACTACCTGACAGAGGCAGCAGCTAACCTACTCTGTCTCTCAAATAGTAGTAAATATCGAGAGAGAATTTTAAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.90% 0.04% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 9.50% 90.30% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 6.00% 93.70% 0.26% 0.00% NA
Tropical Japonica  504 15.70% 84.30% 0.00% 0.00% NA
Japonica Intermediate  241 7.90% 92.10% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621396998 G -> A LOC_Os06g36450.1 5_prime_UTR_variant ; 234.0bp to feature; MODIFIER silent_mutation Average:84.705; most accessible tissue: Callus, score: 94.743 N N N N
vg0621396998 G -> A LOC_Os06g36440.1 upstream_gene_variant ; 2336.0bp to feature; MODIFIER silent_mutation Average:84.705; most accessible tissue: Callus, score: 94.743 N N N N
vg0621396998 G -> A LOC_Os06g36460.1 upstream_gene_variant ; 3838.0bp to feature; MODIFIER silent_mutation Average:84.705; most accessible tissue: Callus, score: 94.743 N N N N
vg0621396998 G -> A LOC_Os06g36430.1 downstream_gene_variant ; 4488.0bp to feature; MODIFIER silent_mutation Average:84.705; most accessible tissue: Callus, score: 94.743 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0621396998 G A -0.1 -0.11 -0.07 -0.02 -0.08 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621396998 NA 2.50E-16 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 1.18E-07 9.32E-09 mr1010 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 1.18E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 4.95E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 8.52E-06 8.52E-06 mr1267 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 1.35E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 1.77E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 1.20E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 8.64E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 1.25E-21 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 1.79E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 4.09E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 1.87E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 2.65E-07 NA mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 4.12E-06 mr1842_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621396998 NA 1.13E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251