\
| Variant ID: vg0621384427 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21384427 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGCAGTAGCAGTTAGAAGCTCCCCAAACAGACTCAAAAGGTCTTATATATTTGGACACTTATAAAAGTCAGACACTTACAAAAGTCAACTCCAGATAAA[C/G]
GAGAAACACTACGGGGCGGACGTAGGTTTGAGGCCACATGGATTAATGACCGTACTGAATGAGCAAGGCGGCATTGAAAGAATAAATACTTGATTGCCTC
GAGGCAATCAAGTATTTATTCTTTCAATGCCGCCTTGCTCATTCAGTACGGTCATTAATCCATGTGGCCTCAAACCTACGTCCGCCCCGTAGTGTTTCTC[G/C]
TTTATCTGGAGTTGACTTTTGTAAGTGTCTGACTTTTATAAGTGTCCAAATATATAAGACCTTTTGAGTCTGTTTGGGGAGCTTCTAACTGCTACTGCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 6.90% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 80.40% | 18.90% | 0.73% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.10% | 1.80% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 49.80% | 49.60% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 19.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 12.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621384427 | C -> G | LOC_Os06g36420.1 | downstream_gene_variant ; 1559.0bp to feature; MODIFIER | silent_mutation | Average:44.087; most accessible tissue: Callus, score: 83.378 | N | N | N | N |
| vg0621384427 | C -> G | LOC_Os06g36410-LOC_Os06g36420 | intergenic_region ; MODIFIER | silent_mutation | Average:44.087; most accessible tissue: Callus, score: 83.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621384427 | NA | 4.24E-11 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621384427 | NA | 1.38E-09 | mr1243 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621384427 | NA | 2.62E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621384427 | NA | 9.22E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621384427 | NA | 4.65E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621384427 | NA | 3.32E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |