\
| Variant ID: vg0621381864 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21381864 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 109. )
AACACCGTTAAATCCTGGAAAATTCGCTCCCTTGGGGAGTCGAACCCAGGACCTCAGGTGCTACTGAAGCTCTTGTAACCACTAGGTTACAGGCCCTTTC[G/A]
CAATCGATTGTAAACTTTTGAAGCAACTACTGGATTGAATTCTATTATCTTAAAAAATAATACAAAATGAAGATCTCTGATACCACAAAGATCCGTTCCA
TGGAACGGATCTTTGTGGTATCAGAGATCTTCATTTTGTATTATTTTTTAAGATAATAGAATTCAATCCAGTAGTTGCTTCAAAAGTTTACAATCGATTG[C/T]
GAAAGGGCCTGTAACCTAGTGGTTACAAGAGCTTCAGTAGCACCTGAGGTCCTGGGTTCGACTCCCCAAGGGAGCGAATTTTCCAGGATTTAACGGTGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.10% | 27.60% | 15.55% | 12.72% | NA |
| All Indica | 2759 | 8.80% | 44.50% | 25.44% | 21.28% | NA |
| All Japonica | 1512 | 94.50% | 4.00% | 1.26% | 0.20% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 1.20% | 40.30% | 41.68% | 16.81% | NA |
| Indica II | 465 | 8.60% | 45.40% | 24.52% | 21.51% | NA |
| Indica III | 913 | 12.20% | 49.30% | 14.68% | 23.88% | NA |
| Indica Intermediate | 786 | 10.80% | 41.50% | 26.21% | 21.50% | NA |
| Temperate Japonica | 767 | 94.70% | 3.80% | 1.30% | 0.26% | NA |
| Tropical Japonica | 504 | 93.80% | 5.20% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.40% | 2.50% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 57.80% | 17.80% | 14.44% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621381864 | G -> A | LOC_Os06g36400.1 | upstream_gene_variant ; 4551.0bp to feature; MODIFIER | silent_mutation | Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg0621381864 | G -> A | LOC_Os06g36410.1 | upstream_gene_variant ; 2530.0bp to feature; MODIFIER | silent_mutation | Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg0621381864 | G -> A | LOC_Os06g36420.1 | downstream_gene_variant ; 4122.0bp to feature; MODIFIER | silent_mutation | Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg0621381864 | G -> A | LOC_Os06g36410-LOC_Os06g36420 | intergenic_region ; MODIFIER | silent_mutation | Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| vg0621381864 | G -> DEL | N | N | silent_mutation | Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621381864 | NA | 3.07E-13 | mr1010 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | 1.25E-06 | 8.10E-07 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 6.98E-16 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 1.45E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 1.35E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 4.19E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 5.07E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 3.13E-06 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 1.18E-13 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 4.51E-14 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 1.01E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 1.78E-17 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621381864 | NA | 2.59E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |