\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621381864:

Variant ID: vg0621381864 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21381864
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AACACCGTTAAATCCTGGAAAATTCGCTCCCTTGGGGAGTCGAACCCAGGACCTCAGGTGCTACTGAAGCTCTTGTAACCACTAGGTTACAGGCCCTTTC[G/A]
CAATCGATTGTAAACTTTTGAAGCAACTACTGGATTGAATTCTATTATCTTAAAAAATAATACAAAATGAAGATCTCTGATACCACAAAGATCCGTTCCA

Reverse complement sequence

TGGAACGGATCTTTGTGGTATCAGAGATCTTCATTTTGTATTATTTTTTAAGATAATAGAATTCAATCCAGTAGTTGCTTCAAAAGTTTACAATCGATTG[C/T]
GAAAGGGCCTGTAACCTAGTGGTTACAAGAGCTTCAGTAGCACCTGAGGTCCTGGGTTCGACTCCCCAAGGGAGCGAATTTTCCAGGATTTAACGGTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.10% 27.60% 15.55% 12.72% NA
All Indica  2759 8.80% 44.50% 25.44% 21.28% NA
All Japonica  1512 94.50% 4.00% 1.26% 0.20% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 1.20% 40.30% 41.68% 16.81% NA
Indica II  465 8.60% 45.40% 24.52% 21.51% NA
Indica III  913 12.20% 49.30% 14.68% 23.88% NA
Indica Intermediate  786 10.80% 41.50% 26.21% 21.50% NA
Temperate Japonica  767 94.70% 3.80% 1.30% 0.26% NA
Tropical Japonica  504 93.80% 5.20% 0.79% 0.20% NA
Japonica Intermediate  241 95.40% 2.50% 2.07% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 57.80% 17.80% 14.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621381864 G -> A LOC_Os06g36400.1 upstream_gene_variant ; 4551.0bp to feature; MODIFIER silent_mutation Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0621381864 G -> A LOC_Os06g36410.1 upstream_gene_variant ; 2530.0bp to feature; MODIFIER silent_mutation Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0621381864 G -> A LOC_Os06g36420.1 downstream_gene_variant ; 4122.0bp to feature; MODIFIER silent_mutation Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0621381864 G -> A LOC_Os06g36410-LOC_Os06g36420 intergenic_region ; MODIFIER silent_mutation Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0621381864 G -> DEL N N silent_mutation Average:53.565; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621381864 NA 3.07E-13 mr1010 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 1.25E-06 8.10E-07 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 6.98E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 1.45E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 1.35E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 4.19E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 5.07E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 3.13E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 1.18E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 4.51E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 1.01E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 1.78E-17 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621381864 NA 2.59E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251