RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0621367808:

Variant ID: vg0621367808 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21367808
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGTCGTCCTCCACTCCTCCGTCGCTATCCTCATCGTCGTCGTCCACATCCCCCGCCGCCGCCGCCTCCGCATCACCCGCCGCTGCTCCGTGCCCCCTGC[T/C]
GCCGCCGACCTGTGAGAGAGAGAGAATAGAGAGAGGAAGAGTGAGAGAGGAAGAGTGGAAGAGGAGTATGACAGGTGGGTCCTATATTTTTTAATAAATA

Reverse complement sequence

TATTTATTAAAAAATATAGGACCCACCTGTCATACTCCTCTTCCACTCTTCCTCTCTCACTCTTCCTCTCTCTATTCTCTCTCTCTCACAGGTCGGCGGC[A/G]
GCAGGGGGCACGGAGCAGCGGCGGGTGATGCGGAGGCGGCGGCGGCGGGGGATGTGGACGACGACGATGAGGATAGCGACGGAGGAGTGGAGGACGACGC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	6.60%	3.15%	0.00%	NA
All Indica	2759	99.50%	0.10%	0.36%	0.00%	NA
All Japonica	1512	74.00%	19.80%	6.15%	0.00%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.70%	0.00%	0.33%	0.00%	NA
Indica Intermediate	786	99.10%	0.00%	0.89%	0.00%	NA
Temperate Japonica	767	61.10%	32.20%	6.65%	0.00%	NA
Tropical Japonica	504	91.50%	5.80%	2.78%	0.00%	NA
Japonica Intermediate	241	78.40%	10.00%	11.62%	0.00%	NA
VI/Aromatic	96	60.40%	0.00%	39.58%	0.00%	NA
Intermediate	90	85.60%	8.90%	5.56%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621367808	T -> C	LOC_Os06g36390.1	upstream_gene_variant ; 4555.0bp to feature; MODIFIER	silent_mutation	Average:68.451; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0621367808	T -> C	LOC_Os06g36390.2	upstream_gene_variant ; 4555.0bp to feature; MODIFIER	silent_mutation	Average:68.451; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0621367808	T -> C	LOC_Os06g36380.1	downstream_gene_variant ; 4156.0bp to feature; MODIFIER	silent_mutation	Average:68.451; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0621367808	T -> C	LOC_Os06g36380-LOC_Os06g36390	intergenic_region ; MODIFIER	silent_mutation	Average:68.451; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621367808	NA	4.31E-06	mr1187_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621367808	NA	7.92E-06	mr1331_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621367808	5.42E-06	NA	mr1381_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0621367808:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact