\
| Variant ID: vg0621355218 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21355218 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 236. )
ACTATGCCATCAGCTTTGCATTACTTAGGTGACGACTCCCTTGTATTTTGCCACCATTGATGCCTCCACGGCCGGTTATCCACTTTAGATCCACTACACC[A/G]
CTGCCAGCCTCACCACACCTCCCCAATCTCTCCCAACATAAAAAAAACAATTTCCTAGTCACTAGGAACGCATGATGACACCCTTGGAAGCCTGAGATCC
GGATCTCAGGCTTCCAAGGGTGTCATCATGCGTTCCTAGTGACTAGGAAATTGTTTTTTTTATGTTGGGAGAGATTGGGGAGGTGTGGTGAGGCTGGCAG[T/C]
GGTGTAGTGGATCTAAAGTGGATAACCGGCCGTGGAGGCATCAATGGTGGCAAAATACAAGGGAGTCGTCACCTAAGTAATGCAAAGCTGATGGCATAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 31.30% | 0.06% | 0.02% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 7.70% | 92.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.30% | 87.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621355218 | A -> G | LOC_Os06g36360.1 | upstream_gene_variant ; 4825.0bp to feature; MODIFIER | silent_mutation | Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0621355218 | A -> G | LOC_Os06g36370.1 | downstream_gene_variant ; 1979.0bp to feature; MODIFIER | silent_mutation | Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0621355218 | A -> G | LOC_Os06g36370-LOC_Os06g36380 | intergenic_region ; MODIFIER | silent_mutation | Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0621355218 | A -> DEL | N | N | silent_mutation | Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621355218 | NA | 5.91E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 4.26E-56 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 6.47E-80 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 1.30E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | 3.33E-07 | 3.33E-07 | mr1267 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 7.20E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 2.10E-58 | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 5.50E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 5.01E-37 | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 5.64E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 6.74E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 7.00E-21 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 1.10E-14 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 8.70E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 2.07E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 3.57E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621355218 | NA | 6.33E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |