\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621355218:

Variant ID: vg0621355218 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21355218
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATGCCATCAGCTTTGCATTACTTAGGTGACGACTCCCTTGTATTTTGCCACCATTGATGCCTCCACGGCCGGTTATCCACTTTAGATCCACTACACC[A/G]
CTGCCAGCCTCACCACACCTCCCCAATCTCTCCCAACATAAAAAAAACAATTTCCTAGTCACTAGGAACGCATGATGACACCCTTGGAAGCCTGAGATCC

Reverse complement sequence

GGATCTCAGGCTTCCAAGGGTGTCATCATGCGTTCCTAGTGACTAGGAAATTGTTTTTTTTATGTTGGGAGAGATTGGGGAGGTGTGGTGAGGCTGGCAG[T/C]
GGTGTAGTGGATCTAAAGTGGATAACCGGCCGTGGAGGCATCAATGGTGGCAAAATACAAGGGAGTCGTCACCTAAGTAATGCAAAGCTGATGGCATAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 31.30% 0.06% 0.02% NA
All Indica  2759 98.90% 1.00% 0.04% 0.04% NA
All Japonica  1512 7.70% 92.30% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 5.20% 94.80% 0.00% 0.00% NA
Tropical Japonica  504 12.30% 87.50% 0.20% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621355218 A -> G LOC_Os06g36360.1 upstream_gene_variant ; 4825.0bp to feature; MODIFIER silent_mutation Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0621355218 A -> G LOC_Os06g36370.1 downstream_gene_variant ; 1979.0bp to feature; MODIFIER silent_mutation Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0621355218 A -> G LOC_Os06g36370-LOC_Os06g36380 intergenic_region ; MODIFIER silent_mutation Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0621355218 A -> DEL N N silent_mutation Average:75.117; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621355218 NA 5.91E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 4.26E-56 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 6.47E-80 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 1.30E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 3.33E-07 3.33E-07 mr1267 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 7.20E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 2.10E-58 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 5.50E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 5.01E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 5.64E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 6.74E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 7.00E-21 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 1.10E-14 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 8.70E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 2.07E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 3.57E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621355218 NA 6.33E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251