Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621266883:

Variant ID: vg0621266883 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21266883
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTAGCGCGACTGCTCCCTGTTCGTCCGCGAAGGTTCGTCTTCCTCTTCGCTCACGTGCTGCGCGCC[G/T]
TCGTAGATGCCTGCAATCATGAAAAGTTCCTGCCGAGTAGCCGGTCTTTCTACCACCTCGGTACGTGTTCAATATGTTGCACATATTTGATCTGTTCATG

Reverse complement sequence

CATGAACAGATCAAATATGTGCAACATATTGAACACGTACCGAGGTGGTAGAAAGACCGGCTACTCGGCAGGAACTTTTCATGATTGCAGGCATCTACGA[C/A]
GGCGCGCAGCACGTGAGCGAAGAGGAAGACGAACCTTCGCGGACGAACAGGGAGCAGTCGCGCTAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	32.50%	1.46%	7.77%	NA
All Indica	2759	95.40%	1.30%	0.98%	2.36%	NA
All Japonica	1512	4.80%	93.80%	0.13%	1.19%	NA
Aus	269	1.50%	1.10%	4.09%	93.31%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	94.80%	2.60%	0.00%	2.58%	NA
Indica III	913	96.50%	0.30%	1.53%	1.64%	NA
Indica Intermediate	786	91.20%	2.30%	1.65%	4.83%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	7.70%	88.70%	0.20%	3.37%	NA
Japonica Intermediate	241	6.20%	92.90%	0.41%	0.41%	NA
VI/Aromatic	96	4.20%	39.60%	27.08%	29.17%	NA
Intermediate	90	46.70%	44.40%	3.33%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621266883	G -> T	LOC_Os06g36280.1	downstream_gene_variant ; 4505.0bp to feature; MODIFIER	silent_mutation	Average:40.462; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0621266883	G -> T	LOC_Os06g36290.1	downstream_gene_variant ; 1012.0bp to feature; MODIFIER	silent_mutation	Average:40.462; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0621266883	G -> T	LOC_Os06g36290-LOC_Os06g36310	intergenic_region ; MODIFIER	silent_mutation	Average:40.462; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0621266883	G -> DEL	N	N	silent_mutation	Average:40.462; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621266883	NA	8.17E-14	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	6.23E-07	8.24E-07	mr1010	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	1.97E-74	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	1.76E-58	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	1.58E-19	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	6.28E-70	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	1.22E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	4.24E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	1.46E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	3.45E-73	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	9.41E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	4.84E-69	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	2.46E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	7.43E-31	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	2.78E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	3.24E-35	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	3.83E-52	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	8.55E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	3.69E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	4.92E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	9.09E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	1.20E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	1.07E-10	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	1.29E-14	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621266883	NA	3.97E-73	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251