\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621263242:

Variant ID: vg0621263242 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21263242
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGTGAAATGAATGGGGTGTTGACGAAGGGTGGAAAACGATATTTCATGACGTTGATTGATGATGCTACTAGATTTTGCTATGTGTACTTGTTGAAAAC[G/A]
AAAGACGAGGCTGTAGACTATTTTAAAATTTATAAGGCAGAAGTTGAAAATCAACTTGACAGAAAGATAAAAAGACTTAGGTCTGATCGTGGTGGAGAGT

Reverse complement sequence

ACTCTCCACCACGATCAGACCTAAGTCTTTTTATCTTTCTGTCAAGTTGATTTTCAACTTCTGCCTTATAAATTTTAAAATAGTCTACAGCCTCGTCTTT[C/T]
GTTTTCAACAAGTACACATAGCAAAATCTAGTAGCATCATCAATCAACGTCATGAAATATCGTTTTCCACCCTTCGTCAACACCCCATTCATTTCACAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 1.10% 3.49% 4.95% NA
All Indica  2759 97.40% 0.00% 1.23% 1.34% NA
All Japonica  1512 92.70% 3.50% 2.71% 1.06% NA
Aus  269 11.90% 0.00% 29.74% 58.36% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.20% 0.00% 1.29% 1.51% NA
Indica III  913 98.20% 0.00% 0.77% 0.99% NA
Indica Intermediate  786 94.70% 0.00% 2.67% 2.67% NA
Temperate Japonica  767 91.90% 4.30% 3.78% 0.00% NA
Tropical Japonica  504 92.30% 3.20% 1.59% 2.98% NA
Japonica Intermediate  241 96.30% 1.70% 1.66% 0.41% NA
VI/Aromatic  96 69.80% 0.00% 10.42% 19.79% NA
Intermediate  90 94.40% 0.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621263242 G -> A LOC_Os06g36290.1 upstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg0621263242 G -> A LOC_Os06g36270.1 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg0621263242 G -> A LOC_Os06g36280.1 downstream_gene_variant ; 864.0bp to feature; MODIFIER silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg0621263242 G -> A LOC_Os06g36270.4 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg0621263242 G -> A LOC_Os06g36270.5 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg0621263242 G -> A LOC_Os06g36270.2 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg0621263242 G -> A LOC_Os06g36270.3 downstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg0621263242 G -> A LOC_Os06g36280-LOC_Os06g36290 intergenic_region ; MODIFIER silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg0621263242 G -> DEL N N silent_mutation Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621263242 1.70E-06 1.70E-06 mr1430_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251