Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621263242:

Variant ID: vg0621263242 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21263242
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGTGAAATGAATGGGGTGTTGACGAAGGGTGGAAAACGATATTTCATGACGTTGATTGATGATGCTACTAGATTTTGCTATGTGTACTTGTTGAAAAC[G/A]
AAAGACGAGGCTGTAGACTATTTTAAAATTTATAAGGCAGAAGTTGAAAATCAACTTGACAGAAAGATAAAAAGACTTAGGTCTGATCGTGGTGGAGAGT

Reverse complement sequence

ACTCTCCACCACGATCAGACCTAAGTCTTTTTATCTTTCTGTCAAGTTGATTTTCAACTTCTGCCTTATAAATTTTAAAATAGTCTACAGCCTCGTCTTT[C/T]
GTTTTCAACAAGTACACATAGCAAAATCTAGTAGCATCATCAATCAACGTCATGAAATATCGTTTTCCACCCTTCGTCAACACCCCATTCATTTCACAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.40%	1.10%	3.49%	4.95%	NA
All Indica	2759	97.40%	0.00%	1.23%	1.34%	NA
All Japonica	1512	92.70%	3.50%	2.71%	1.06%	NA
Aus	269	11.90%	0.00%	29.74%	58.36%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.20%	0.00%	1.29%	1.51%	NA
Indica III	913	98.20%	0.00%	0.77%	0.99%	NA
Indica Intermediate	786	94.70%	0.00%	2.67%	2.67%	NA
Temperate Japonica	767	91.90%	4.30%	3.78%	0.00%	NA
Tropical Japonica	504	92.30%	3.20%	1.59%	2.98%	NA
Japonica Intermediate	241	96.30%	1.70%	1.66%	0.41%	NA
VI/Aromatic	96	69.80%	0.00%	10.42%	19.79%	NA
Intermediate	90	94.40%	0.00%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621263242	G -> A	LOC_Os06g36290.1	upstream_gene_variant ; 849.0bp to feature; MODIFIER	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0621263242	G -> A	LOC_Os06g36270.1	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0621263242	G -> A	LOC_Os06g36280.1	downstream_gene_variant ; 864.0bp to feature; MODIFIER	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0621263242	G -> A	LOC_Os06g36270.4	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0621263242	G -> A	LOC_Os06g36270.5	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0621263242	G -> A	LOC_Os06g36270.2	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0621263242	G -> A	LOC_Os06g36270.3	downstream_gene_variant ; 3320.0bp to feature; MODIFIER	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0621263242	G -> A	LOC_Os06g36280-LOC_Os06g36290	intergenic_region ; MODIFIER	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0621263242	G -> DEL	N	N	silent_mutation	Average:24.265; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621263242	1.70E-06	1.70E-06	mr1430_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251