\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621194085:

Variant ID: vg0621194085 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21194085
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 27. )

Flanking Sequence (100 bp) in Reference Genome:


CAAATATCCCACATTTCTATTAAATGTTGCATTCTTTTACAATGTCATGTGGGATGGGTCCTATTACTCAGCCATATATTGTTTACCTTATGCCATTGAT[G/A]
ACTTGGGTATCAAAATGACTAGATGTTGGTTTAGGAAATGCTTAGCCATGCCTAGCTCAACTAGTACACAAATGGGGATCACATTATTACATAGACTTTG

Reverse complement sequence

CAAAGTCTATGTAATAATGTGATCCCCATTTGTGTACTAGTTGAGCTAGGCATGGCTAAGCATTTCCTAAACCAACATCTAGTCATTTTGATACCCAAGT[C/T]
ATCAATGGCATAAGGTAAACAATATATGGCTGAGTAATAGGACCCATCCCACATGACATTGTAAAAGAATGCAACATTTAATAGAAATGTGGGATATTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 19.50% 16.72% 29.92% NA
All Indica  2759 3.00% 25.30% 22.29% 49.40% NA
All Japonica  1512 94.50% 2.10% 1.92% 1.52% NA
Aus  269 1.10% 56.50% 40.89% 1.49% NA
Indica I  595 2.00% 4.70% 21.34% 71.93% NA
Indica II  465 4.10% 34.40% 16.56% 44.95% NA
Indica III  913 2.40% 38.20% 19.50% 39.87% NA
Indica Intermediate  786 3.90% 20.40% 29.64% 46.06% NA
Temperate Japonica  767 97.70% 0.70% 0.39% 1.30% NA
Tropical Japonica  504 90.10% 4.20% 3.97% 1.79% NA
Japonica Intermediate  241 93.80% 2.10% 2.49% 1.66% NA
VI/Aromatic  96 44.80% 18.80% 32.29% 4.17% NA
Intermediate  90 46.70% 25.60% 5.56% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621194085 G -> A LOC_Os06g36190.1 upstream_gene_variant ; 1984.0bp to feature; MODIFIER silent_mutation Average:17.551; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0621194085 G -> A LOC_Os06g36180.1 downstream_gene_variant ; 1896.0bp to feature; MODIFIER silent_mutation Average:17.551; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0621194085 G -> A LOC_Os06g36180-LOC_Os06g36190 intergenic_region ; MODIFIER silent_mutation Average:17.551; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0621194085 G -> DEL N N silent_mutation Average:17.551; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621194085 NA 1.18E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 2.28E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 1.58E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 6.88E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 3.75E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 5.72E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 5.72E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 7.01E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 8.35E-06 NA mr1063_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 6.90E-06 mr1066_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 1.58E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 8.05E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 1.29E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 4.89E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 9.42E-09 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 1.24E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 7.39E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 4.31E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 2.51E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 5.86E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 2.45E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 3.13E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 1.83E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 2.75E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 5.14E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 8.05E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 1.54E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 5.34E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 6.06E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 1.85E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621194085 NA 5.14E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251