\
| Variant ID: vg0621183896 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21183896 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGGTAAATAAAATGCTACCTACTCACCGGTAAATTTTTTGAATAAGACGAGTGGTCAAACAGTACAAGCAAAAACTCAAAATCCCTTATATTATGGAAC[A/G]
GAGGGAGTACTATAGAAGCAATTATATTTTAGGAGCGAGGGATTAGTGTAAAAGAACGACAACAAAAGCCACTGGATTAATTTTCTTAATTCCTATGAGC
GCTCATAGGAATTAAGAAAATTAATCCAGTGGCTTTTGTTGTCGTTCTTTTACACTAATCCCTCGCTCCTAAAATATAATTGCTTCTATAGTACTCCCTC[T/C]
GTTCCATAATATAAGGGATTTTGAGTTTTTGCTTGTACTGTTTGACCACTCGTCTTATTCAAAAAATTTACCGGTGAGTAGGTAGCATTTTATTTACCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 14.80% | 1.50% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 51.20% | 44.20% | 4.63% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 20.90% | 74.30% | 4.82% | 0.00% | NA |
| Tropical Japonica | 504 | 90.10% | 5.80% | 4.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 28.60% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621183896 | A -> G | LOC_Os06g36180.1 | upstream_gene_variant ; 1004.0bp to feature; MODIFIER | silent_mutation | Average:34.727; most accessible tissue: Minghui63 root, score: 57.225 | N | N | N | N |
| vg0621183896 | A -> G | LOC_Os06g36170-LOC_Os06g36180 | intergenic_region ; MODIFIER | silent_mutation | Average:34.727; most accessible tissue: Minghui63 root, score: 57.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621183896 | NA | 2.59E-11 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621183896 | 5.22E-08 | NA | mr1768_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621183896 | 4.83E-07 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621183896 | 5.14E-07 | NA | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621183896 | NA | 5.97E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |