RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0621146125:

Variant ID: vg0621146125 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21146125
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTACAAGGGTTACGCCGTTATCATAATCGGAATGTTCGATCGCGAGCCTTTTTAGTCGGCGACCTGGTTCTGAGGAGAATTCAAACTACACAGGATCGG[T/C]
ATAAGTTATCTCCCTTGTGGGAAGGACCGTTCATAATCGCTGAAGTTACTCGGCCAGGTTCTTACCGACTCAAGCGTGAAGATGGTACTCTTGTCAACAA

Reverse complement sequence

TTGTTGACAAGAGTACCATCTTCACGCTTGAGTCGGTAAGAACCTGGCCGAGTAACTTCAGCGATTATGAACGGTCCTTCCCACAAGGGAGATAACTTAT[A/G]
CCGATCCTGTGTAGTTTGAATTCTCCTCAGAACCAGGTCGCCGACTAAAAAGGCTCGCGATCGAACATTCCGATTATGATAACGGCGTAACCCTTGTAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.10%	23.10%	39.44%	4.40%	NA
All Indica	2759	2.50%	25.70%	64.62%	7.25%	NA
All Japonica	1512	93.50%	3.20%	2.98%	0.33%	NA
Aus	269	0.00%	99.30%	0.74%	0.00%	NA
Indica I	595	1.00%	18.80%	73.45%	6.72%	NA
Indica II	465	2.80%	14.40%	75.05%	7.74%	NA
Indica III	913	2.20%	35.00%	54.87%	7.89%	NA
Indica Intermediate	786	3.70%	26.60%	63.10%	6.62%	NA
Temperate Japonica	767	97.70%	0.80%	1.43%	0.13%	NA
Tropical Japonica	504	87.30%	6.70%	5.36%	0.60%	NA
Japonica Intermediate	241	93.40%	3.30%	2.90%	0.41%	NA
VI/Aromatic	96	42.70%	54.20%	3.12%	0.00%	NA
Intermediate	90	44.40%	17.80%	34.44%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621146125	T -> C	LOC_Os06g36130.1	missense_variant ; p.Tyr347His; MODERATE	nonsynonymous_codon ; Y347H	Average:21.3; most accessible tissue: Zhenshan97 flower, score: 31.8	possibly damaging	-1.565	TOLERATED	1.00
vg0621146125	T -> DEL	LOC_Os06g36130.1	N	frameshift_variant	Average:21.3; most accessible tissue: Zhenshan97 flower, score: 31.8	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621146125	NA	2.41E-74	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	2.96E-58	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	1.59E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	8.43E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	1.17E-69	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	9.84E-82	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	3.35E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	9.67E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	2.12E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621146125	NA	1.56E-26	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 50 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0621146125:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact