\
| Variant ID: vg0621137518 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21137518 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATAGCCACCCCCTTTTAGTATTGCTGAAACCTTGTTTCGACAGTTGGCGCGCCAGGTAGGGACAGCGTCAAGTTTTTGCCGACTAAGTGCGATGGGTTC[T/C]
GTCTCCGGCATCGACGACTTCGCCTTTCCTCCCGGGCAGGCGTTCCGGTTCGGCAGCCTCAACTTCATCACCAATGACTTCGGCAAGATCTCTCTCCTTG
CAAGGAGAGAGATCTTGCCGAAGTCATTGGTGATGAAGTTGAGGCTGCCGAACCGGAACGCCTGCCCGGGAGGAAAGGCGAAGTCGTCGATGCCGGAGAC[A/G]
GAACCCATCGCACTTAGTCGGCAAAAACTTGACGCTGTCCCTACCTGGCGCGCCAACTGTCGAAACAAGGTTTCAGCAATACTAAAAGGGGGTGGCTATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 32.20% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 6.50% | 93.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 12.70% | 87.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.60% | 93.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 41.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621137518 | T -> C | LOC_Os06g36110.1 | synonymous_variant ; p.Ser3Ser; LOW | synonymous_codon | Average:60.144; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621137518 | NA | 1.23E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 6.31E-78 | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 4.36E-62 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.25E-72 | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.22E-84 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 3.90E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 9.85E-27 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.00E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 9.39E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 4.86E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 8.07E-59 | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.96E-11 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.19E-76 | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | 5.03E-08 | NA | mr1829 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | 3.59E-10 | NA | mr1842 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | 4.80E-08 | 4.80E-08 | mr1842 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.33E-34 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 3.23E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.15E-72 | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 2.38E-24 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 7.59E-32 | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 5.11E-79 | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 9.26E-102 | mr1134_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 2.48E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.06E-18 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 4.44E-36 | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 3.68E-56 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 9.16E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.84E-20 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 3.16E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 4.61E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.18E-75 | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 6.70E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 3.16E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.54E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.79E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 7.50E-15 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 9.64E-78 | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | 4.51E-09 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | 8.88E-10 | NA | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 4.11E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 2.92E-66 | mr1889_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 2.81E-64 | mr1896_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621137518 | NA | 1.09E-92 | mr1907_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |