Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621097248:

Variant ID: vg0621097248 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21097248
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGTCCCTTATATAGGGGTTGGTCTTACCCTCTACAGGCCCTCCTCCATGTCTAACTCGAGATAGAATCCAAAGAAAACCCGAAACATGTCTTCCCGAG[C/T]
AAGAAAACTTCAAGACCCGGCGAAACGGTACCGGACTCGGACTCTGCTGGTCAGACCGGCCACACATCGCCGGTTTGACCAGCCCTCAACCGGCGGTCTG

Reverse complement sequence

CAGACCGCCGGTTGAGGGCTGGTCAAACCGGCGATGTGTGGCCGGTCTGACCAGCAGAGTCCGAGTCCGGTACCGTTTCGCCGGGTCTTGAAGTTTTCTT[G/A]
CTCGGGAAGACATGTTTCGGGTTTTCTTTGGATTCTATCTCGAGTTAGACATGGAGGAGGGCCTGTAGAGGGTAAGACCAACCCCTATATAAGGGACATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	8.10%	0.57%	0.00%	NA
All Indica	2759	97.00%	2.80%	0.14%	0.00%	NA
All Japonica	1512	98.60%	1.30%	0.07%	0.00%	NA
Aus	269	2.60%	97.00%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	97.70%	2.20%	0.11%	0.00%	NA
Indica Intermediate	786	93.90%	5.70%	0.38%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	62.50%	15.60%	21.88%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621097248	C -> T	LOC_Os06g36070-LOC_Os06g36080	intergenic_region ; MODIFIER	silent_mutation	Average:71.516; most accessible tissue: Minghui63 root, score: 87.205	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0621097248	C	T	-0.03	-0.02	-0.03	-0.01	-0.02	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621097248	NA	9.97E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621097248	NA	2.02E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621097248	NA	1.80E-37	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621097248	NA	7.29E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621097248	NA	1.29E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621097248	4.98E-06	NA	mr1201_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621097248	NA	1.23E-31	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621097248	NA	1.58E-16	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251