Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621076898:

Variant ID: vg0621076898 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21076898
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

ATATATATATATTCCTTGACCATCATATTTTGTTCCTATGTGTTTACACGTGTCACTAATTTGTGTTGTACATGTTATACGCAAATTCAGGTAATAGACT[G/A]
TGTGTTTTCGTGAGAGATTACTACTGCTATAAGTTCCAAATACGACCTGGCTTATTCAACCCTATATTGTATGGTGGGCGTCTTTTCCAGCAGTTTGCGG

Reverse complement sequence

CCGCAAACTGCTGGAAAAGACGCCCACCATACAATATAGGGTTGAATAAGCCAGGTCGTATTTGGAACTTATAGCAGTAGTAATCTCTCACGAAAACACA[C/T]
AGTCTATTACCTGAATTTGCGTATAACATGTACAACACAAATTAGTGACACGTGTAAACACATAGGAACAAAATATGATGGTCAAGGAATATATATATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	18.40%	2.96%	1.27%	NA
All Indica	2759	64.70%	30.60%	4.64%	0.07%	NA
All Japonica	1512	99.00%	0.70%	0.20%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	26.60%	65.00%	8.40%	0.00%	NA
Indica II	465	46.20%	48.80%	4.95%	0.00%	NA
Indica III	913	97.20%	1.20%	1.53%	0.11%	NA
Indica Intermediate	786	66.70%	28.00%	5.22%	0.13%	NA
Temperate Japonica	767	98.80%	0.90%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.40%	0.41%	0.83%	NA
VI/Aromatic	96	42.70%	0.00%	4.17%	53.12%	NA
Intermediate	90	71.10%	17.80%	5.56%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621076898	G -> A	LOC_Os06g36060.1	synonymous_variant ; p.Leu470Leu; LOW	synonymous_codon	Average:35.664; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg0621076898	G -> DEL	LOC_Os06g36060.1	N	frameshift_variant	Average:35.664; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621076898	NA	1.59E-09	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	1.41E-10	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	5.27E-07	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	8.44E-07	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	4.07E-07	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	1.35E-09	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	1.01E-11	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	6.42E-11	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	2.68E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	6.98E-23	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	1.43E-10	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	8.84E-11	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	2.68E-11	mr1242_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	2.03E-07	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	2.65E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	8.93E-06	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	5.43E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	5.05E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	6.71E-16	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	7.84E-09	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	2.01E-13	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	1.25E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	6.12E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	1.15E-24	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898	NA	3.52E-09	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251