\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621076898:

Variant ID: vg0621076898 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21076898
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATATATATTCCTTGACCATCATATTTTGTTCCTATGTGTTTACACGTGTCACTAATTTGTGTTGTACATGTTATACGCAAATTCAGGTAATAGACT[G/A]
TGTGTTTTCGTGAGAGATTACTACTGCTATAAGTTCCAAATACGACCTGGCTTATTCAACCCTATATTGTATGGTGGGCGTCTTTTCCAGCAGTTTGCGG

Reverse complement sequence

CCGCAAACTGCTGGAAAAGACGCCCACCATACAATATAGGGTTGAATAAGCCAGGTCGTATTTGGAACTTATAGCAGTAGTAATCTCTCACGAAAACACA[C/T]
AGTCTATTACCTGAATTTGCGTATAACATGTACAACACAAATTAGTGACACGTGTAAACACATAGGAACAAAATATGATGGTCAAGGAATATATATATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 18.40% 2.96% 1.27% NA
All Indica  2759 64.70% 30.60% 4.64% 0.07% NA
All Japonica  1512 99.00% 0.70% 0.20% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 26.60% 65.00% 8.40% 0.00% NA
Indica II  465 46.20% 48.80% 4.95% 0.00% NA
Indica III  913 97.20% 1.20% 1.53% 0.11% NA
Indica Intermediate  786 66.70% 28.00% 5.22% 0.13% NA
Temperate Japonica  767 98.80% 0.90% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 0.41% 0.83% NA
VI/Aromatic  96 42.70% 0.00% 4.17% 53.12% NA
Intermediate  90 71.10% 17.80% 5.56% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621076898 G -> A LOC_Os06g36060.1 synonymous_variant ; p.Leu470Leu; LOW synonymous_codon Average:35.664; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg0621076898 G -> DEL LOC_Os06g36060.1 N frameshift_variant Average:35.664; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621076898 NA 1.59E-09 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 1.41E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 5.27E-07 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 8.44E-07 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 4.07E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 1.35E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 1.01E-11 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 6.42E-11 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 2.68E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 6.98E-23 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 1.43E-10 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 8.84E-11 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 2.68E-11 mr1242_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 2.03E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 2.65E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 8.93E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 5.43E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 5.05E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 6.71E-16 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 7.84E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 2.01E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 1.25E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 6.12E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 1.15E-24 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621076898 NA 3.52E-09 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251