\
| Variant ID: vg0621053788 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21053788 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 101. )
TTCGCAAATATTCATTTAAAGAGCATATAAACTTCAAATGGCCATAACTTGGCCATTTGAACTCGGAATTGGACCGTTCAAGTCTCTAATTTTTCCTTAA[T/G]
AAGTCAAGAACCCATTTTTGTGCTTTGTTCCTGCTTGTTATATGGAGTTTATTAGAGTAAAAGCCTTTTCTTTTTTTCGTTGGTCGTGTAGACGCCGCAG
CTGCGGCGTCTACACGACCAACGAAAAAAAGAAAAGGCTTTTACTCTAATAAACTCCATATAACAAGCAGGAACAAAGCACAAAAATGGGTTCTTGACTT[A/C]
TTAAGGAAAAATTAGAGACTTGAACGGTCCAATTCCGAGTTCAAATGGCCAAGTTATGGCCATTTGAAGTTTATATGCTCTTTAAATGAATATTTGCGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.70% | 0.30% | 3.24% | 64.79% | NA |
| All Indica | 2759 | 1.40% | 0.00% | 1.41% | 97.10% | NA |
| All Japonica | 1512 | 94.30% | 0.00% | 0.40% | 5.29% | NA |
| Aus | 269 | 0.00% | 3.00% | 18.96% | 78.07% | NA |
| Indica I | 595 | 0.70% | 0.00% | 0.17% | 99.16% | NA |
| Indica II | 465 | 2.40% | 0.00% | 1.08% | 96.56% | NA |
| Indica III | 913 | 0.90% | 0.00% | 1.86% | 97.26% | NA |
| Indica Intermediate | 786 | 2.20% | 0.10% | 2.04% | 95.67% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.13% | 1.96% | NA |
| Tropical Japonica | 504 | 89.30% | 0.00% | 0.79% | 9.92% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.00% | 0.41% | 6.22% | NA |
| VI/Aromatic | 96 | 1.00% | 3.10% | 53.12% | 42.71% | NA |
| Intermediate | 90 | 33.30% | 2.20% | 6.67% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621053788 | T -> G | LOC_Os06g36010.1 | upstream_gene_variant ; 4065.0bp to feature; MODIFIER | silent_mutation | Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0621053788 | T -> G | LOC_Os06g36020.1 | downstream_gene_variant ; 2173.0bp to feature; MODIFIER | silent_mutation | Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0621053788 | T -> G | LOC_Os06g36010-LOC_Os06g36020 | intergenic_region ; MODIFIER | silent_mutation | Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0621053788 | T -> DEL | N | N | silent_mutation | Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621053788 | NA | 1.17E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 1.67E-08 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 5.65E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 1.77E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 2.77E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 4.31E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 4.44E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 8.14E-18 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | 1.70E-06 | 3.06E-06 | mr1749_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 6.37E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 3.26E-16 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621053788 | NA | 1.17E-12 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |