\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621053788:

Variant ID: vg0621053788 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21053788
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGCAAATATTCATTTAAAGAGCATATAAACTTCAAATGGCCATAACTTGGCCATTTGAACTCGGAATTGGACCGTTCAAGTCTCTAATTTTTCCTTAA[T/G]
AAGTCAAGAACCCATTTTTGTGCTTTGTTCCTGCTTGTTATATGGAGTTTATTAGAGTAAAAGCCTTTTCTTTTTTTCGTTGGTCGTGTAGACGCCGCAG

Reverse complement sequence

CTGCGGCGTCTACACGACCAACGAAAAAAAGAAAAGGCTTTTACTCTAATAAACTCCATATAACAAGCAGGAACAAAGCACAAAAATGGGTTCTTGACTT[A/C]
TTAAGGAAAAATTAGAGACTTGAACGGTCCAATTCCGAGTTCAAATGGCCAAGTTATGGCCATTTGAAGTTTATATGCTCTTTAAATGAATATTTGCGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 0.30% 3.24% 64.79% NA
All Indica  2759 1.40% 0.00% 1.41% 97.10% NA
All Japonica  1512 94.30% 0.00% 0.40% 5.29% NA
Aus  269 0.00% 3.00% 18.96% 78.07% NA
Indica I  595 0.70% 0.00% 0.17% 99.16% NA
Indica II  465 2.40% 0.00% 1.08% 96.56% NA
Indica III  913 0.90% 0.00% 1.86% 97.26% NA
Indica Intermediate  786 2.20% 0.10% 2.04% 95.67% NA
Temperate Japonica  767 97.90% 0.00% 0.13% 1.96% NA
Tropical Japonica  504 89.30% 0.00% 0.79% 9.92% NA
Japonica Intermediate  241 93.40% 0.00% 0.41% 6.22% NA
VI/Aromatic  96 1.00% 3.10% 53.12% 42.71% NA
Intermediate  90 33.30% 2.20% 6.67% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621053788 T -> G LOC_Os06g36010.1 upstream_gene_variant ; 4065.0bp to feature; MODIFIER silent_mutation Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0621053788 T -> G LOC_Os06g36020.1 downstream_gene_variant ; 2173.0bp to feature; MODIFIER silent_mutation Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0621053788 T -> G LOC_Os06g36010-LOC_Os06g36020 intergenic_region ; MODIFIER silent_mutation Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0621053788 T -> DEL N N silent_mutation Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621053788 NA 1.17E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 1.67E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 5.65E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 1.77E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 2.77E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 4.31E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 4.44E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 8.14E-18 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 1.70E-06 3.06E-06 mr1749_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 6.37E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 3.26E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788 NA 1.17E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251