Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621053788:

Variant ID: vg0621053788 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21053788
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGCAAATATTCATTTAAAGAGCATATAAACTTCAAATGGCCATAACTTGGCCATTTGAACTCGGAATTGGACCGTTCAAGTCTCTAATTTTTCCTTAA[T/G]
AAGTCAAGAACCCATTTTTGTGCTTTGTTCCTGCTTGTTATATGGAGTTTATTAGAGTAAAAGCCTTTTCTTTTTTTCGTTGGTCGTGTAGACGCCGCAG

Reverse complement sequence

CTGCGGCGTCTACACGACCAACGAAAAAAAGAAAAGGCTTTTACTCTAATAAACTCCATATAACAAGCAGGAACAAAGCACAAAAATGGGTTCTTGACTT[A/C]
TTAAGGAAAAATTAGAGACTTGAACGGTCCAATTCCGAGTTCAAATGGCCAAGTTATGGCCATTTGAAGTTTATATGCTCTTTAAATGAATATTTGCGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.70%	0.30%	3.24%	64.79%	NA
All Indica	2759	1.40%	0.00%	1.41%	97.10%	NA
All Japonica	1512	94.30%	0.00%	0.40%	5.29%	NA
Aus	269	0.00%	3.00%	18.96%	78.07%	NA
Indica I	595	0.70%	0.00%	0.17%	99.16%	NA
Indica II	465	2.40%	0.00%	1.08%	96.56%	NA
Indica III	913	0.90%	0.00%	1.86%	97.26%	NA
Indica Intermediate	786	2.20%	0.10%	2.04%	95.67%	NA
Temperate Japonica	767	97.90%	0.00%	0.13%	1.96%	NA
Tropical Japonica	504	89.30%	0.00%	0.79%	9.92%	NA
Japonica Intermediate	241	93.40%	0.00%	0.41%	6.22%	NA
VI/Aromatic	96	1.00%	3.10%	53.12%	42.71%	NA
Intermediate	90	33.30%	2.20%	6.67%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621053788	T -> G	LOC_Os06g36010.1	upstream_gene_variant ; 4065.0bp to feature; MODIFIER	silent_mutation	Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg0621053788	T -> G	LOC_Os06g36020.1	downstream_gene_variant ; 2173.0bp to feature; MODIFIER	silent_mutation	Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg0621053788	T -> G	LOC_Os06g36010-LOC_Os06g36020	intergenic_region ; MODIFIER	silent_mutation	Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg0621053788	T -> DEL	N	N	silent_mutation	Average:21.596; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621053788	NA	1.17E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	1.67E-08	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	5.65E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	1.77E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	2.77E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	4.31E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	4.44E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	8.14E-18	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	1.70E-06	3.06E-06	mr1749_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	6.37E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	3.26E-16	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621053788	NA	1.17E-12	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251