Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621037715:

Variant ID: vg0621037715 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 21037715
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

ACATGCAAGTTGGATTTAGCCAATGGCAACAAAGGTTTCACTGTTTATCTAATCATTTAGATTTTATGACATCGGATCTCCAGCCGATGTATGCTTTAAC[C/T]
ATCGGATTAGTGTTTATTCTATTATATTGTTAGCCGATTGGTTTCTACTAGATTATTCTATTGTTATCATCAGCGGATTGTCTTCATATCATTATTTACA

Reverse complement sequence

TGTAAATAATGATATGAAGACAATCCGCTGATGATAACAATAGAATAATCTAGTAGAAACCAATCGGCTAACAATATAATAGAATAAACACTAATCCGAT[G/A]
GTTAAAGCATACATCGGCTGGAGATCCGATGTCATAAAATCTAAATGATTAGATAAACAGTGAAACCTTTGTTGCCATTGGCTAAATCCAACTTGCATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	46.60%	0.02%	0.00%	NA
All Indica	2759	23.50%	76.50%	0.00%	0.00%	NA
All Japonica	1512	96.30%	3.60%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	2.90%	97.10%	0.00%	0.00%	NA
Indica II	465	18.10%	81.90%	0.00%	0.00%	NA
Indica III	913	42.40%	57.60%	0.00%	0.00%	NA
Indica Intermediate	786	20.40%	79.60%	0.00%	0.00%	NA
Temperate Japonica	767	98.20%	1.70%	0.13%	0.00%	NA
Tropical Japonica	504	93.30%	6.70%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621037715	C -> T	LOC_Os06g36000.1	upstream_gene_variant ; 2998.0bp to feature; MODIFIER	silent_mutation	Average:39.731; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0621037715	C -> T	LOC_Os06g35990-LOC_Os06g36000	intergenic_region ; MODIFIER	silent_mutation	Average:39.731; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621037715	NA	1.11E-08	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	2.53E-54	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	3.85E-39	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	5.26E-46	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	6.13E-28	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	4.62E-47	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	2.79E-45	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	2.46E-06	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	1.81E-15	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	9.63E-06	NA	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	4.04E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	6.12E-25	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	2.69E-62	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	8.68E-62	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	1.70E-35	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	4.85E-57	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	7.90E-25	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	2.10E-07	NA	mr1695_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	2.03E-08	1.20E-07	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	4.13E-11	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	1.39E-10	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621037715	NA	2.63E-25	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251