\
| Variant ID: vg0620931744 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20931744 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, G: 0.17, others allele: 0.00, population size: 93. )
CACATGGAAAAATGATGGGGCCTCGTACAGAAAAATCACTTTTGTAGTAGTGTCACTCGCAGCCAGAGGAAGCCCTTCACCTGATGAGCTTGTTGCAAGA[T/G]
AGCGCCAGAAATGACAAGCTTTTAGATATGATTGACCACAGGATGGATGACATGCAGCTTCATTCTTAAGATGTAATGCACATGATGCATCTCGCAATGT
ACATTGCGAGATGCATCATGTGCATTACATCTTAAGAATGAAGCTGCATGTCATCCATCCTGTGGTCAATCATATCTAAAAGCTTGTCATTTCTGGCGCT[A/C]
TCTTGCAACAAGCTCATCAGGTGAAGGGCTTCCTCTGGCTGCGAGTGACACTACTACAAAAGTGATTTTTCTGTACGAGGCCCCATCATTTTTCCATGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 47.60% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 73.80% | 25.90% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 3.10% | 96.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 67.50% | 31.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 57.70% | 42.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 80.00% | 19.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620931744 | T -> G | LOC_Os06g35880.1 | missense_variant ; p.Tyr162Ser; MODERATE | nonsynonymous_codon ; Y162S | Average:62.756; most accessible tissue: Minghui63 panicle, score: 74.563 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620931744 | NA | 1.67E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620931744 | NA | 3.38E-06 | mr1549_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620931744 | NA | 8.18E-09 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620931744 | NA | 9.69E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620931744 | NA | 1.17E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620931744 | 4.71E-06 | 4.71E-06 | mr1666_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620931744 | NA | 3.25E-06 | mr1734_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620931744 | NA | 1.14E-06 | mr1761_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |