\
| Variant ID: vg0620904318 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20904318 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTCTTGTATGCGAAATGATTTATTTATCTTTTTTCTCTTCTCATTAACTTTCTTTGCCACCTTAACTTTTGCTTATGTGACAACGTACTTAACACTTT[G/A]
AAAACTAAGGTGGAGGGTTGGGAGTGCCCTTACTTATCGGTGCTCCTTTTCTTGTCTGTAACCTGGCTGTCCCAATTGATTATATGACCGTGTCTGACGA
TCGTCAGACACGGTCATATAATCAATTGGGACAGCCAGGTTACAGACAAGAAAAGGAGCACCGATAAGTAAGGGCACTCCCAACCCTCCACCTTAGTTTT[C/T]
AAAGTGTTAAGTACGTTGTCACATAAGCAAAAGTTAAGGTGGCAAAGAAAGTTAATGAGAAGAGAAAAAAGATAAATAAATCATTTCGCATACAAGAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 14.70% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 56.30% | 42.80% | 0.93% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 84.90% | 13.80% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 15.90% | 83.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.80% | 49.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620904318 | G -> A | LOC_Os06g35814.1 | upstream_gene_variant ; 2602.0bp to feature; MODIFIER | silent_mutation | Average:57.958; most accessible tissue: Callus, score: 73.741 | N | N | N | N |
| vg0620904318 | G -> A | LOC_Os06g35830.1 | upstream_gene_variant ; 1693.0bp to feature; MODIFIER | silent_mutation | Average:57.958; most accessible tissue: Callus, score: 73.741 | N | N | N | N |
| vg0620904318 | G -> A | LOC_Os06g35814-LOC_Os06g35830 | intergenic_region ; MODIFIER | silent_mutation | Average:57.958; most accessible tissue: Callus, score: 73.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620904318 | NA | 7.98E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 3.37E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 3.08E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 2.17E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 2.18E-06 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 4.21E-07 | mr1187_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 2.94E-06 | mr1331_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 1.75E-06 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 1.71E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 1.93E-06 | mr1544_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 1.35E-06 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | 3.04E-06 | 3.43E-10 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 3.45E-11 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 5.24E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | 3.39E-07 | 7.21E-11 | mr1821_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620904318 | NA | 6.70E-06 | mr1821_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |