\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620879823:

Variant ID: vg0620879823 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 20879823
Reference Allele: TTCAlternative Allele: CTC,T,ATC
Primary Allele: TSecondary Allele: TTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTAAACATGTGATCCGAATTTTGGGCCCATAATATATTCGGATTAGTTTTTTAGTAGGAGTTTCTATTAGGTGTCTTTCTTTTATCCTCTATATATACT[TTC/CTC,T,ATC]
GTAAGCCGTACGGGAAGGGTGACGTTCCCATTGTGATTCCTCTACGTTTGTAATCAACATCTTTATAGTGGTTATTGTCGGTCGGCGCATGTGGTTTTCT

Reverse complement sequence

AGAAAACCACATGCGCCGACCGACAATAACCACTATAAAGATGTTGATTACAAACGTAGAGGAATCACAATGGGAACGTCACCCTTCCCGTACGGCTTAC[GAA/GAG,A,GAT]
AGTATATATAGAGGATAAAAGAAAGACACCTAATAGAAACTCCTACTAAAAAACTAATCCGAATATATTATGGGCCCAAAATTCGGATCACATGTTTAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 29.50% 0.25% 2.45% ATC: 1.63%; CTC: 0.99%
All Indica  2759 96.70% 1.30% 0.33% 0.14% CTC: 1.49%
All Japonica  1512 3.90% 87.50% 0.07% 3.64% ATC: 4.83%; CTC: 0.07%
Aus  269 98.90% 0.00% 0.00% 0.00% CTC: 1.12%
Indica I  595 97.10% 0.70% 0.50% 0.00% CTC: 1.68%
Indica II  465 95.30% 2.80% 1.08% 0.00% CTC: 0.86%
Indica III  913 98.70% 0.10% 0.00% 0.22% CTC: 0.99%
Indica Intermediate  786 94.90% 2.40% 0.13% 0.25% CTC: 2.29%
Temperate Japonica  767 2.60% 91.10% 0.00% 0.78% ATC: 5.35%; CTC: 0.13%
Tropical Japonica  504 6.30% 92.50% 0.00% 1.19% NA
Japonica Intermediate  241 2.90% 65.60% 0.41% 17.84% ATC: 13.28%
VI/Aromatic  96 45.80% 0.00% 0.00% 51.04% CTC: 2.08%; ATC: 1.04%
Intermediate  90 50.00% 35.60% 2.22% 8.89% ATC: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620879823 TTC -> DEL N N silent_mutation Average:92.803; most accessible tissue: Zhenshan97 panicle, score: 98.054 N N N N
vg0620879823 TTC -> T LOC_Os06g35780.1 intron_variant ; MODIFIER silent_mutation Average:92.803; most accessible tissue: Zhenshan97 panicle, score: 98.054 N N N N
vg0620879823 TTC -> CTC LOC_Os06g35780.1 intron_variant ; MODIFIER silent_mutation Average:92.803; most accessible tissue: Zhenshan97 panicle, score: 98.054 N N N N
vg0620879823 TTC -> ATC LOC_Os06g35780.1 intron_variant ; MODIFIER silent_mutation Average:92.803; most accessible tissue: Zhenshan97 panicle, score: 98.054 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620879823 TTC ATC 0.06 0.06 0.05 0.05 0.04 0.03
vg0620879823 TTC CTC 0.03 0.02 0.01 0.03 0.02 0.0
vg0620879823 TTC T 0.11 0.13 0.09 0.13 0.11 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620879823 NA 9.04E-24 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.05E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 4.64E-38 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.50E-26 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.54E-40 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 3.19E-30 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.09E-31 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.18E-64 mr1103 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 3.07E-33 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 5.98E-31 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 4.42E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 9.11E-28 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 3.27E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.65E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.85E-29 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 7.17E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 2.29E-61 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 3.68E-28 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 8.72E-41 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.48E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.00E-13 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 5.63E-42 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 4.22E-43 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 3.79E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 9.00E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 8.93E-61 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 6.59E-47 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 4.46E-33 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 6.73E-71 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 4.66E-71 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 8.23E-37 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.26E-41 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 5.03E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 2.57E-34 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 4.09E-41 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 2.98E-75 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.32E-39 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.15E-14 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 2.93E-45 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.24E-31 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.73E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 3.94E-47 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 1.38E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 2.57E-35 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 2.61E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620879823 NA 4.20E-22 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251