\
| Variant ID: vg0620866647 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20866647 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAATATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAACATGTGATAAAAAGTCAA[C/A]
GGCGTCAAACATTTCGAAACGGAGGGAGTATGTTGTAGTATGACTTGTGCTTTAATGAAATCTCTCCATTGTCTAACGAATGTAACACTACCATCTAGAT
ATCTAGATGGTAGTGTTACATTCGTTAGACAATGGAGAGATTTCATTAAAGCACAAGTCATACTACAACATACTCCCTCCGTTTCGAAATGTTTGACGCC[G/T]
TTGACTTTTTATCACATGTTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATATTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.80% | 15.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 55.80% | 44.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.90% | 86.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620866647 | C -> A | LOC_Os06g35750.1 | upstream_gene_variant ; 4298.0bp to feature; MODIFIER | silent_mutation | Average:49.488; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0620866647 | C -> A | LOC_Os06g35760.1 | downstream_gene_variant ; 797.0bp to feature; MODIFIER | silent_mutation | Average:49.488; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0620866647 | C -> A | LOC_Os06g35770.1 | downstream_gene_variant ; 1776.0bp to feature; MODIFIER | silent_mutation | Average:49.488; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0620866647 | C -> A | LOC_Os06g35760-LOC_Os06g35770 | intergenic_region ; MODIFIER | silent_mutation | Average:49.488; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620866647 | NA | 7.07E-14 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 2.28E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 1.98E-06 | mr1187_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 1.31E-06 | mr1331_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 3.31E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 3.54E-14 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 2.70E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | 2.95E-06 | 3.18E-10 | mr1749_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 8.33E-06 | mr1749_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 4.25E-12 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | NA | 4.41E-06 | mr1761_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620866647 | 1.05E-06 | 1.94E-10 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |