\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620866647:

Variant ID: vg0620866647 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20866647
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAATATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAACATGTGATAAAAAGTCAA[C/A]
GGCGTCAAACATTTCGAAACGGAGGGAGTATGTTGTAGTATGACTTGTGCTTTAATGAAATCTCTCCATTGTCTAACGAATGTAACACTACCATCTAGAT

Reverse complement sequence

ATCTAGATGGTAGTGTTACATTCGTTAGACAATGGAGAGATTTCATTAAAGCACAAGTCATACTACAACATACTCCCTCCGTTTCGAAATGTTTGACGCC[G/T]
TTGACTTTTTATCACATGTTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 15.20% 0.02% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 55.80% 44.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 85.10% 14.90% 0.00% 0.00% NA
Tropical Japonica  504 13.90% 86.10% 0.00% 0.00% NA
Japonica Intermediate  241 49.80% 50.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620866647 C -> A LOC_Os06g35750.1 upstream_gene_variant ; 4298.0bp to feature; MODIFIER silent_mutation Average:49.488; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0620866647 C -> A LOC_Os06g35760.1 downstream_gene_variant ; 797.0bp to feature; MODIFIER silent_mutation Average:49.488; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0620866647 C -> A LOC_Os06g35770.1 downstream_gene_variant ; 1776.0bp to feature; MODIFIER silent_mutation Average:49.488; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0620866647 C -> A LOC_Os06g35760-LOC_Os06g35770 intergenic_region ; MODIFIER silent_mutation Average:49.488; most accessible tissue: Minghui63 root, score: 73.73 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620866647 NA 7.07E-14 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 2.28E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 1.98E-06 mr1187_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 1.31E-06 mr1331_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 3.31E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 3.54E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 2.70E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 2.95E-06 3.18E-10 mr1749_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 8.33E-06 mr1749_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 4.25E-12 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 NA 4.41E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620866647 1.05E-06 1.94E-10 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251