\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620820526:

Variant ID: vg0620820526 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20820526
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTATTTGGAAATAGCCCACCCAAAAAAACTATCCCAACCAAGGGGTGCTAATTGGAGCTATTTTGAGTGGAGCCCACTAAAAGGTGTTTTTTCTCTCT[C/T]
CCACAGGCACACGGGATCAGAAAACACGACCACCTCTCTCCCTCTCTCCGCACGACCGCGCGCGTAGGCGAGGGGCATTTTCGCCGCCGCCGCCTCCACT

Reverse complement sequence

AGTGGAGGCGGCGGCGGCGAAAATGCCCCTCGCCTACGCGCGCGGTCGTGCGGAGAGAGGGAGAGAGGTGGTCGTGTTTTCTGATCCCGTGTGCCTGTGG[G/A]
AGAGAGAAAAAACACCTTTTAGTGGGCTCCACTCAAAATAGCTCCAATTAGCACCCCTTGGTTGGGATAGTTTTTTTGGGTGGGCTATTTCCAAATAGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 29.50% 2.35% 2.35% NA
All Indica  2759 92.90% 1.40% 3.81% 1.92% NA
All Japonica  1512 8.90% 87.40% 0.20% 3.51% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 97.30% 0.30% 1.85% 0.50% NA
Indica II  465 90.10% 3.00% 5.38% 1.51% NA
Indica III  913 91.60% 0.30% 5.15% 2.96% NA
Indica Intermediate  786 92.70% 2.40% 2.80% 2.04% NA
Temperate Japonica  767 7.40% 91.30% 0.26% 1.04% NA
Tropical Japonica  504 6.90% 91.90% 0.00% 1.19% NA
Japonica Intermediate  241 17.80% 65.60% 0.41% 16.18% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 56.70% 37.80% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620820526 C -> T LOC_Os06g35670.1 downstream_gene_variant ; 1204.0bp to feature; MODIFIER silent_mutation Average:80.465; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0620820526 C -> T LOC_Os06g35670.2 downstream_gene_variant ; 1204.0bp to feature; MODIFIER silent_mutation Average:80.465; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0620820526 C -> T LOC_Os06g35660-LOC_Os06g35670 intergenic_region ; MODIFIER silent_mutation Average:80.465; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0620820526 C -> DEL N N silent_mutation Average:80.465; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620820526 C T -0.01 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620820526 NA 8.70E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 4.24E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 1.11E-06 NA mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 3.99E-90 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 1.24E-58 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 8.41E-31 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 6.74E-93 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 3.50E-98 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 2.17E-29 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 2.11E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 7.93E-89 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 2.87E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 2.49E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 5.41E-06 NA mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 5.32E-94 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 7.09E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 9.17E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 3.82E-14 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 2.56E-06 2.56E-06 mr1970 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 8.37E-32 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 9.48E-20 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 1.77E-16 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 2.06E-30 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 7.29E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 6.39E-12 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620820526 NA 2.03E-23 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251