\
| Variant ID: vg0620775608 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20775608 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 100. )
AAGTTTGCTCTCAAGATCATTCAGGCTTTGATAGTTTCCATCAAATTCAAATATTTAATTGCATATATACAAGTTGCTTTGGTGAAACTAACCAGCGGGT[G/A]
AAACTCTTGTCATTTCTAACCCCCGCCGAGTTAGTCTGTTCTTGCTCCATTGTGTAGAATGAGGAGGCGATTGTCTCGTCTGTTCAAATGGTCCGGCTCT
AGAGCCGGACCATTTGAACAGACGAGACAATCGCCTCCTCATTCTACACAATGGAGCAAGAACAGACTAACTCGGCGGGGGTTAGAAATGACAAGAGTTT[C/T]
ACCCGCTGGTTAGTTTCACCAAAGCAACTTGTATATATGCAATTAAATATTTGAATTTGATGGAAACTATCAAAGCCTGAATGATCTTGAGAGCAAACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 23.30% | 0.91% | 0.68% | NA |
| All Indica | 2759 | 72.80% | 24.50% | 1.52% | 1.16% | NA |
| All Japonica | 1512 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.80% | 2.70% | 1.34% | 0.17% | NA |
| Indica II | 465 | 66.90% | 29.00% | 3.01% | 1.08% | NA |
| Indica III | 913 | 59.00% | 38.10% | 0.88% | 1.97% | NA |
| Indica Intermediate | 786 | 74.90% | 22.50% | 1.53% | 1.02% | NA |
| Temperate Japonica | 767 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620775608 | G -> A | LOC_Os06g35610.1 | upstream_gene_variant ; 1156.0bp to feature; MODIFIER | silent_mutation | Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0620775608 | G -> A | LOC_Os06g35600.1 | downstream_gene_variant ; 568.0bp to feature; MODIFIER | silent_mutation | Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0620775608 | G -> A | LOC_Os06g35600-LOC_Os06g35610 | intergenic_region ; MODIFIER | silent_mutation | Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0620775608 | G -> DEL | N | N | silent_mutation | Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620775608 | 2.47E-06 | 2.47E-06 | mr1286_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620775608 | NA | 5.01E-06 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620775608 | NA | 2.20E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620775608 | NA | 5.15E-06 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620775608 | NA | 8.07E-06 | mr1764_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620775608 | NA | 7.29E-06 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |