\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620775608:

Variant ID: vg0620775608 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20775608
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTTGCTCTCAAGATCATTCAGGCTTTGATAGTTTCCATCAAATTCAAATATTTAATTGCATATATACAAGTTGCTTTGGTGAAACTAACCAGCGGGT[G/A]
AAACTCTTGTCATTTCTAACCCCCGCCGAGTTAGTCTGTTCTTGCTCCATTGTGTAGAATGAGGAGGCGATTGTCTCGTCTGTTCAAATGGTCCGGCTCT

Reverse complement sequence

AGAGCCGGACCATTTGAACAGACGAGACAATCGCCTCCTCATTCTACACAATGGAGCAAGAACAGACTAACTCGGCGGGGGTTAGAAATGACAAGAGTTT[C/T]
ACCCGCTGGTTAGTTTCACCAAAGCAACTTGTATATATGCAATTAAATATTTGAATTTGATGGAAACTATCAAAGCCTGAATGATCTTGAGAGCAAACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 23.30% 0.91% 0.68% NA
All Indica  2759 72.80% 24.50% 1.52% 1.16% NA
All Japonica  1512 93.20% 6.80% 0.00% 0.00% NA
Aus  269 1.50% 98.10% 0.37% 0.00% NA
Indica I  595 95.80% 2.70% 1.34% 0.17% NA
Indica II  465 66.90% 29.00% 3.01% 1.08% NA
Indica III  913 59.00% 38.10% 0.88% 1.97% NA
Indica Intermediate  786 74.90% 22.50% 1.53% 1.02% NA
Temperate Japonica  767 93.40% 6.60% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620775608 G -> A LOC_Os06g35610.1 upstream_gene_variant ; 1156.0bp to feature; MODIFIER silent_mutation Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0620775608 G -> A LOC_Os06g35600.1 downstream_gene_variant ; 568.0bp to feature; MODIFIER silent_mutation Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0620775608 G -> A LOC_Os06g35600-LOC_Os06g35610 intergenic_region ; MODIFIER silent_mutation Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0620775608 G -> DEL N N silent_mutation Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620775608 2.47E-06 2.47E-06 mr1286_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608 NA 5.01E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608 NA 2.20E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608 NA 5.15E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608 NA 8.07E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608 NA 7.29E-06 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251