Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620775608:

Variant ID: vg0620775608 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20775608
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTTTGCTCTCAAGATCATTCAGGCTTTGATAGTTTCCATCAAATTCAAATATTTAATTGCATATATACAAGTTGCTTTGGTGAAACTAACCAGCGGGT[G/A]
AAACTCTTGTCATTTCTAACCCCCGCCGAGTTAGTCTGTTCTTGCTCCATTGTGTAGAATGAGGAGGCGATTGTCTCGTCTGTTCAAATGGTCCGGCTCT

Reverse complement sequence

AGAGCCGGACCATTTGAACAGACGAGACAATCGCCTCCTCATTCTACACAATGGAGCAAGAACAGACTAACTCGGCGGGGGTTAGAAATGACAAGAGTTT[C/T]
ACCCGCTGGTTAGTTTCACCAAAGCAACTTGTATATATGCAATTAAATATTTGAATTTGATGGAAACTATCAAAGCCTGAATGATCTTGAGAGCAAACTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	23.30%	0.91%	0.68%	NA
All Indica	2759	72.80%	24.50%	1.52%	1.16%	NA
All Japonica	1512	93.20%	6.80%	0.00%	0.00%	NA
Aus	269	1.50%	98.10%	0.37%	0.00%	NA
Indica I	595	95.80%	2.70%	1.34%	0.17%	NA
Indica II	465	66.90%	29.00%	3.01%	1.08%	NA
Indica III	913	59.00%	38.10%	0.88%	1.97%	NA
Indica Intermediate	786	74.90%	22.50%	1.53%	1.02%	NA
Temperate Japonica	767	93.40%	6.60%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620775608	G -> A	LOC_Os06g35610.1	upstream_gene_variant ; 1156.0bp to feature; MODIFIER	silent_mutation	Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0620775608	G -> A	LOC_Os06g35600.1	downstream_gene_variant ; 568.0bp to feature; MODIFIER	silent_mutation	Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0620775608	G -> A	LOC_Os06g35600-LOC_Os06g35610	intergenic_region ; MODIFIER	silent_mutation	Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0620775608	G -> DEL	N	N	silent_mutation	Average:43.045; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620775608	2.47E-06	2.47E-06	mr1286_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608	NA	5.01E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608	NA	2.20E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608	NA	5.15E-06	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608	NA	8.07E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620775608	NA	7.29E-06	mr1827_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251