Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620772509:

Variant ID: vg0620772509 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20772509
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTGTTTCTGCGCCATTGCTGGGAATTATATTTCTAGCGATGTCGTTAAGAAATACCAAAAAGCAATTCTGGCGCCGTTGCTGGGGAAGATTCATAATA[G/A]
AGATTACCTGAACTAATACTTTATATTTACCTTTGTATAATCATTTTCCTTTGCAGGCTAACATTGGTTGTTGTCACTTTTGTTGTGAAAATAGGGTAGT

Reverse complement sequence

ACTACCCTATTTTCACAACAAAAGTGACAACAACCAATGTTAGCCTGCAAAGGAAAATGATTATACAAAGGTAAATATAAAGTATTAGTTCAGGTAATCT[C/T]
TATTATGAATCTTCCCCAGCAACGGCGCCAGAATTGCTTTTTGGTATTTCTTAACGACATCGCTAGAAATATAATTCCCAGCAATGGCGCAGAAACACTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	45.30%	0.21%	0.11%	NA
All Indica	2759	28.50%	71.10%	0.33%	0.14%	NA
All Japonica	1512	94.20%	5.70%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	4.70%	95.30%	0.00%	0.00%	NA
Indica II	465	35.90%	63.90%	0.22%	0.00%	NA
Indica III	913	41.10%	58.40%	0.44%	0.11%	NA
Indica Intermediate	786	27.40%	71.80%	0.51%	0.38%	NA
Temperate Japonica	767	97.50%	2.30%	0.13%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	80.50%	19.50%	0.00%	0.00%	NA
VI/Aromatic	96	40.60%	59.40%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620772509	G -> A	LOC_Os06g35590.1	upstream_gene_variant ; 2824.0bp to feature; MODIFIER	silent_mutation	Average:51.978; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N
vg0620772509	G -> A	LOC_Os06g35600.1	upstream_gene_variant ; 243.0bp to feature; MODIFIER	silent_mutation	Average:51.978; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N
vg0620772509	G -> A	LOC_Os06g35610.1	upstream_gene_variant ; 4255.0bp to feature; MODIFIER	silent_mutation	Average:51.978; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N
vg0620772509	G -> A	LOC_Os06g35590-LOC_Os06g35600	intergenic_region ; MODIFIER	silent_mutation	Average:51.978; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N
vg0620772509	G -> DEL	N	N	silent_mutation	Average:51.978; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620772509	NA	2.67E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772509	1.97E-06	1.97E-06	mr1065_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772509	1.04E-06	1.04E-06	mr1067_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772509	NA	5.44E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772509	NA	1.26E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772509	1.82E-06	5.69E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772509	NA	4.66E-22	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251