Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620772181:

Variant ID: vg0620772181 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20772181
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATATCGGTTGACTAGAATGTATGTATATTATGTATACTAGAAGTATAGGAATATATTCTCTTTCTCTTTTCTTTCCACTTAGCTTAGATAATATATTA[T/C]
GAGAATGAGTAGCTAATGCTTGTGTGTCACTCTACCCCTTGGATTATCTTAACCCCTGCTTAGAATATGGTTATCACAAGTAATATATAAATTATTAGTC

Reverse complement sequence

GACTAATAATTTATATATTACTTGTGATAACCATATTCTAAGCAGGGGTTAAGATAATCCAAGGGGTAGAGTGACACACAAGCATTAGCTACTCATTCTC[A/G]
TAATATATTATCTAAGCTAAGTGGAAAGAAAAGAGAAAGAGAATATATTCCTATACTTCTAGTATACATAATATACATACATTCTAGTCAACCGATATAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.30%	14.70%	0.06%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	56.20%	43.60%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	81.50%	18.40%	0.13%	0.00%	NA
Tropical Japonica	504	21.20%	78.60%	0.20%	0.00%	NA
Japonica Intermediate	241	49.00%	50.60%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620772181	T -> C	LOC_Os06g35590.1	upstream_gene_variant ; 2496.0bp to feature; MODIFIER	silent_mutation	Average:50.601; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0620772181	T -> C	LOC_Os06g35600.1	upstream_gene_variant ; 571.0bp to feature; MODIFIER	silent_mutation	Average:50.601; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0620772181	T -> C	LOC_Os06g35610.1	upstream_gene_variant ; 4583.0bp to feature; MODIFIER	silent_mutation	Average:50.601; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0620772181	T -> C	LOC_Os06g35590-LOC_Os06g35600	intergenic_region ; MODIFIER	silent_mutation	Average:50.601; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620772181	NA	4.76E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	2.21E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	1.46E-06	mr1187_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	5.15E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	1.25E-08	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	1.67E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	9.66E-07	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	6.91E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	2.46E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	1.11E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	4.09E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	1.88E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	7.92E-07	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	1.98E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	1.50E-06	6.29E-10	mr1749_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	9.02E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	4.68E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	5.17E-09	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	5.27E-20	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	5.14E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772181	NA	1.40E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251