\
| Variant ID: vg0620734924 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20734924 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 245. )
CAACTCACCAACATTCTATAATAAGCTACAGGGAACTGAAACAAGATACGACCAATTGTTTCCTTCTTTTGACATACTCCAAAACCATCCTAATTTCCAC[A/G]
ACTAAGTGAACTGCGCAAGGTAAACTATCTCTATCTACCATAAACAAAAAAAAGTTTTATCTTTAGAGATCTAGGGTCTGTATTTAGGGACCTTGTGTGA
TCACACAAGGTCCCTAAATACAGACCCTAGATCTCTAAAGATAAAACTTTTTTTTGTTTATGGTAGATAGAGATAGTTTACCTTGCGCAGTTCACTTAGT[T/C]
GTGGAAATTAGGATGGTTTTGGAGTATGTCAAAAGAAGGAAACAATTGGTCGTATCTTGTTTCAGTTCCCTGTAGCTTATTATAGAATGTTGGTGAGTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.80% | 15.40% | 0.59% | 41.18% | NA |
| All Indica | 2759 | 5.70% | 24.90% | 0.91% | 68.47% | NA |
| All Japonica | 1512 | 97.40% | 0.80% | 0.07% | 1.79% | NA |
| Aus | 269 | 92.20% | 6.70% | 0.00% | 1.12% | NA |
| Indica I | 595 | 3.00% | 4.20% | 1.34% | 91.43% | NA |
| Indica II | 465 | 6.70% | 31.80% | 1.08% | 60.43% | NA |
| Indica III | 913 | 3.20% | 39.90% | 0.11% | 56.85% | NA |
| Indica Intermediate | 786 | 10.20% | 19.10% | 1.40% | 69.34% | NA |
| Temperate Japonica | 767 | 97.10% | 1.30% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 97.20% | 0.20% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 60.00% | 13.30% | 1.11% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620734924 | A -> G | LOC_Os06g35540.1 | upstream_gene_variant ; 3153.0bp to feature; MODIFIER | silent_mutation | Average:41.694; most accessible tissue: Minghui63 flower, score: 71.461 | N | N | N | N |
| vg0620734924 | A -> G | LOC_Os06g35550.1 | downstream_gene_variant ; 1001.0bp to feature; MODIFIER | silent_mutation | Average:41.694; most accessible tissue: Minghui63 flower, score: 71.461 | N | N | N | N |
| vg0620734924 | A -> G | LOC_Os06g35540-LOC_Os06g35550 | intergenic_region ; MODIFIER | silent_mutation | Average:41.694; most accessible tissue: Minghui63 flower, score: 71.461 | N | N | N | N |
| vg0620734924 | A -> DEL | N | N | silent_mutation | Average:41.694; most accessible tissue: Minghui63 flower, score: 71.461 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620734924 | NA | 1.83E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | NA | 1.53E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | NA | 2.17E-07 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | NA | 1.30E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 3.23E-07 | 3.12E-07 | mr1471_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | NA | 9.11E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | NA | 6.97E-08 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 1.75E-06 | 1.75E-06 | mr1663_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | NA | 7.12E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | NA | 1.85E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | NA | 9.38E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 1.03E-06 | 4.35E-07 | mr1812_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 3.08E-07 | 3.08E-07 | mr1812_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 2.91E-06 | NA | mr1832_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 2.34E-06 | 2.34E-06 | mr1832_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 4.40E-06 | NA | mr1833_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 1.33E-06 | 1.33E-06 | mr1833_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 2.18E-06 | 8.76E-06 | mr1834_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 3.01E-06 | NA | mr1843_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 2.58E-06 | 2.58E-06 | mr1843_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620734924 | 3.86E-06 | 3.86E-06 | mr1847_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |