\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620733763:

Variant ID: vg0620733763 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20733763
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTCCCGTTAGAGAGGTAGGAGGGAGGTACCTCGATAGTGCCCCAATGGGGTTACGGCATCCTCGAAAATAACTAGCTAGACTTAAGCCTAGACCCCT[A/G]
CAACCATCTTGTCATAGTTCGTTGCCCATCATCTCAATTACCATCATCCAAACGTGACCGCACATGGCCTCCACCACACTGGACCAACACCCTTTTGCCG

Reverse complement sequence

CGGCAAAAGGGTGTTGGTCCAGTGTGGTGGAGGCCATGTGCGGTCACGTTTGGATGATGGTAATTGAGATGATGGGCAACGAACTATGACAAGATGGTTG[T/C]
AGGGGTCTAGGCTTAAGTCTAGCTAGTTATTTTCGAGGATGCCGTAACCCCATTGGGGCACTATCGAGGTACCTCCCTCCTACCTCTCTAACGGGAATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.90% 28.40% 1.18% 40.56% NA
All Indica  2759 2.10% 28.60% 1.85% 67.49% NA
All Japonica  1512 87.50% 10.70% 0.13% 1.65% NA
Aus  269 0.00% 98.90% 0.00% 1.12% NA
Indica I  595 1.50% 4.50% 2.86% 91.09% NA
Indica II  465 3.90% 34.80% 2.37% 58.92% NA
Indica III  913 0.90% 42.50% 0.99% 55.64% NA
Indica Intermediate  786 2.90% 26.80% 1.78% 68.45% NA
Temperate Japonica  767 90.90% 7.60% 0.13% 1.43% NA
Tropical Japonica  504 92.30% 5.40% 0.20% 2.18% NA
Japonica Intermediate  241 66.80% 32.00% 0.00% 1.24% NA
VI/Aromatic  96 0.00% 95.80% 0.00% 4.17% NA
Intermediate  90 33.30% 37.80% 3.33% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620733763 A -> G LOC_Os06g35540.1 upstream_gene_variant ; 1992.0bp to feature; MODIFIER silent_mutation Average:51.712; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg0620733763 A -> G LOC_Os06g35550.1 downstream_gene_variant ; 2162.0bp to feature; MODIFIER silent_mutation Average:51.712; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg0620733763 A -> G LOC_Os06g35540-LOC_Os06g35550 intergenic_region ; MODIFIER silent_mutation Average:51.712; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg0620733763 A -> DEL N N silent_mutation Average:51.712; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620733763 A G -0.01 -0.01 -0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620733763 NA 8.02E-07 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 5.10E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 1.65E-06 NA mr1047_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 6.72E-06 NA mr1062_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 1.83E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 1.87E-06 NA mr1189_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 2.31E-06 2.32E-06 mr1286_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 9.88E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 9.62E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 6.01E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 2.31E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 1.22E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 9.41E-06 mr1522_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 1.62E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 5.27E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 5.31E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 1.26E-06 1.26E-06 mr1663_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 2.85E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 9.14E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 8.76E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 9.43E-06 8.09E-08 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 1.43E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 2.44E-06 6.91E-07 mr1768_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 6.23E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 2.78E-06 3.03E-07 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 2.29E-06 2.29E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 2.21E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 4.52E-06 4.17E-06 mr1834_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 3.08E-06 9.06E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 5.77E-06 5.77E-06 mr1843_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 6.42E-06 6.42E-06 mr1847_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620733763 NA 7.09E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251