\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620707239:

Variant ID: vg0620707239 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20707239
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGCACGCGCGATTCAGGCATGGGTCCCAGAGTCTCCTGCACGTCGTCGTCGTCTCGTTGCTAAACTACTTATATACTACCCCTGTTTTTAATAGATAA[C/T,A]
GTCGTTGATTTTTTCTTACATGTTTGACTATTCATCTTATTTAAAAAATTTATGTAATTATAATTTATTTTGTTATGAGTTATTTTATCACTCATAGTAC

Reverse complement sequence

GTACTATGAGTGATAAAATAACTCATAACAAAATAAATTATAATTACATAAATTTTTTAAATAAGATGAATAGTCAAACATGTAAGAAAAAATCAACGAC[G/A,T]
TTATCTATTAAAAACAGGGGTAGTATATAAGTAGTTTAGCAACGAGACGACGACGACGTGCAGGAGACTCTGGGACCCATGCCTGAATCGCGCGTGCCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 10.70% 0.15% 0.00% A: 1.23%
All Indica  2759 95.50% 4.20% 0.25% 0.00% A: 0.07%
All Japonica  1512 90.40% 6.00% 0.00% 0.00% A: 3.57%
Aus  269 8.60% 91.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 94.00% 5.40% 0.55% 0.00% A: 0.11%
Indica Intermediate  786 93.60% 6.00% 0.25% 0.00% A: 0.13%
Temperate Japonica  767 94.00% 5.20% 0.00% 0.00% A: 0.78%
Tropical Japonica  504 94.80% 3.80% 0.00% 0.00% A: 1.39%
Japonica Intermediate  241 69.70% 13.30% 0.00% 0.00% A: 17.01%
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 0.00% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620707239 C -> T LOC_Os06g35510.1 upstream_gene_variant ; 3849.0bp to feature; MODIFIER silent_mutation Average:89.819; most accessible tissue: Callus, score: 99.617 N N N N
vg0620707239 C -> T LOC_Os06g35520.1 upstream_gene_variant ; 242.0bp to feature; MODIFIER silent_mutation Average:89.819; most accessible tissue: Callus, score: 99.617 N N N N
vg0620707239 C -> T LOC_Os06g35520-LOC_Os06g35524 intergenic_region ; MODIFIER silent_mutation Average:89.819; most accessible tissue: Callus, score: 99.617 N N N N
vg0620707239 C -> A LOC_Os06g35510.1 upstream_gene_variant ; 3849.0bp to feature; MODIFIER silent_mutation Average:89.819; most accessible tissue: Callus, score: 99.617 N N N N
vg0620707239 C -> A LOC_Os06g35520.1 upstream_gene_variant ; 242.0bp to feature; MODIFIER silent_mutation Average:89.819; most accessible tissue: Callus, score: 99.617 N N N N
vg0620707239 C -> A LOC_Os06g35520-LOC_Os06g35524 intergenic_region ; MODIFIER silent_mutation Average:89.819; most accessible tissue: Callus, score: 99.617 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620707239 C A 0.02 0.0 0.0 0.03 0.03 0.0
vg0620707239 C T 0.01 -0.03 -0.02 0.01 -0.03 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620707239 NA 5.81E-09 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 1.27E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 9.73E-11 mr1415 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 8.19E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 9.73E-11 mr1567 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 2.19E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 5.35E-06 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 8.67E-06 8.67E-06 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 5.16E-07 1.14E-07 mr1037_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 1.01E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 9.02E-09 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 6.13E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 3.88E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 3.66E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 6.59E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 7.23E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 4.90E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 1.58E-06 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620707239 NA 4.30E-07 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251