\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620632643:

Variant ID: vg0620632643 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20632643
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCCTTTGTAATATGTGGTTTCCATCATATAATCCCATACCAACTAAATTAGCGCTATTACCTACCAAGGGGCCTGAACCAGTATAATCCTTGTCTTTT[G/A]
TTTGCTTGATATCGTACTACGTAGATCCTCGTACCAACATACCCCAATACCCTCTATATCCGGTTTACAGGTATGCCCCGTCAACAGTCGACAGTCTGAG

Reverse complement sequence

CTCAGACTGTCGACTGTTGACGGGGCATACCTGTAAACCGGATATAGAGGGTATTGGGGTATGTTGGTACGAGGATCTACGTAGTACGATATCAAGCAAA[C/T]
AAAAGACAAGGATTATACTGGTTCAGGCCCCTTGGTAGGTAATAGCGCTAATTTAGTTGGTATGGGATTATATGATGGAAACCACATATTACAAAGGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 17.50% 0.11% 0.00% NA
All Indica  2759 98.90% 1.00% 0.04% 0.00% NA
All Japonica  1512 48.30% 51.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 75.70% 24.30% 0.00% 0.00% NA
Tropical Japonica  504 11.90% 87.90% 0.20% 0.00% NA
Japonica Intermediate  241 36.90% 63.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 76.70% 20.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620632643 G -> A LOC_Os06g35390.1 upstream_gene_variant ; 2976.0bp to feature; MODIFIER silent_mutation Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0620632643 G -> A LOC_Os06g35400.1 downstream_gene_variant ; 229.0bp to feature; MODIFIER silent_mutation Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0620632643 G -> A LOC_Os06g35410.1 downstream_gene_variant ; 2704.0bp to feature; MODIFIER silent_mutation Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0620632643 G -> A LOC_Os06g35400-LOC_Os06g35410 intergenic_region ; MODIFIER silent_mutation Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620632643 NA 4.18E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 1.12E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 7.61E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 1.46E-19 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 4.47E-07 NA mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 5.18E-06 NA mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 1.55E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 2.75E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 3.30E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 3.70E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 9.09E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620632643 NA 5.16E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251