\
| Variant ID: vg0620632643 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20632643 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 268. )
TTCCCTTTGTAATATGTGGTTTCCATCATATAATCCCATACCAACTAAATTAGCGCTATTACCTACCAAGGGGCCTGAACCAGTATAATCCTTGTCTTTT[G/A]
TTTGCTTGATATCGTACTACGTAGATCCTCGTACCAACATACCCCAATACCCTCTATATCCGGTTTACAGGTATGCCCCGTCAACAGTCGACAGTCTGAG
CTCAGACTGTCGACTGTTGACGGGGCATACCTGTAAACCGGATATAGAGGGTATTGGGGTATGTTGGTACGAGGATCTACGTAGTACGATATCAAGCAAA[C/T]
AAAAGACAAGGATTATACTGGTTCAGGCCCCTTGGTAGGTAATAGCGCTAATTTAGTTGGTATGGGATTATATGATGGAAACCACATATTACAAAGGGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 17.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 48.30% | 51.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 75.70% | 24.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.90% | 87.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.90% | 63.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 20.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620632643 | G -> A | LOC_Os06g35390.1 | upstream_gene_variant ; 2976.0bp to feature; MODIFIER | silent_mutation | Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0620632643 | G -> A | LOC_Os06g35400.1 | downstream_gene_variant ; 229.0bp to feature; MODIFIER | silent_mutation | Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0620632643 | G -> A | LOC_Os06g35410.1 | downstream_gene_variant ; 2704.0bp to feature; MODIFIER | silent_mutation | Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0620632643 | G -> A | LOC_Os06g35400-LOC_Os06g35410 | intergenic_region ; MODIFIER | silent_mutation | Average:63.612; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620632643 | NA | 4.18E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 1.12E-12 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 7.61E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 1.46E-19 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | 4.47E-07 | NA | mr1174_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | 5.18E-06 | NA | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 1.55E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 2.75E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 3.30E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 3.70E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 9.09E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620632643 | NA | 5.16E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |