\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620630387:

Variant ID: vg0620630387 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20630387
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAATAATAAAAGGGGGTGGCTATCAAGCTAGGAAAGTGGATGGGTTTGGAGACAAGGAATTTTATACAGGTTCAGGCCTTCTTATTCAAGAAGTAATA[T/C]
CCTACTCCTGTCCGGGGATGATTCCGCCGAGTATGTAATTGATTGTATGATTGGGAAAAAAGAATCGTCCCGAGAGGAACACGGACCCCTCCTTATATAG

Reverse complement sequence

CTATATAAGGAGGGGTCCGTGTTCCTCTCGGGACGATTCTTTTTTCCCAATCATACAATCAATTACATACTCGGCGGAATCATCCCCGGACAGGAGTAGG[A/G]
TATTACTTCTTGAATAAGAAGGCCTGAACCTGTATAAAATTCCTTGTCTCCAAACCCATCCACTTTCCTAGCTTGATAGCCACCCCCTTTTATTATTGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.40% 0.04% 0.00% NA
All Indica  2759 99.70% 0.30% 0.04% 0.00% NA
All Japonica  1512 56.20% 43.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 27.20% 72.80% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.60% 0.20% 0.00% NA
Japonica Intermediate  241 66.80% 33.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620630387 T -> C LOC_Os06g35390.1 upstream_gene_variant ; 720.0bp to feature; MODIFIER silent_mutation Average:15.133; most accessible tissue: Callus, score: 26.045 N N N N
vg0620630387 T -> C LOC_Os06g35400.1 upstream_gene_variant ; 1429.0bp to feature; MODIFIER silent_mutation Average:15.133; most accessible tissue: Callus, score: 26.045 N N N N
vg0620630387 T -> C LOC_Os06g35380.1 downstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:15.133; most accessible tissue: Callus, score: 26.045 N N N N
vg0620630387 T -> C LOC_Os06g35410.1 downstream_gene_variant ; 4960.0bp to feature; MODIFIER silent_mutation Average:15.133; most accessible tissue: Callus, score: 26.045 N N N N
vg0620630387 T -> C LOC_Os06g35390-LOC_Os06g35400 intergenic_region ; MODIFIER silent_mutation Average:15.133; most accessible tissue: Callus, score: 26.045 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620630387 NA 1.59E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 1.49E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 2.04E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 9.87E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 5.60E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 5.90E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 2.14E-14 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 2.83E-07 4.55E-20 mr1165_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 1.59E-08 2.13E-09 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 4.16E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 1.44E-06 2.52E-32 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 7.42E-07 7.42E-07 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 1.45E-06 2.24E-10 mr1478_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 7.18E-07 7.18E-07 mr1478_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 1.51E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 4.59E-49 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 1.43E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 8.82E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 2.73E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 2.07E-12 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 NA 2.90E-23 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 1.51E-06 3.69E-24 mr1971_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620630387 8.41E-08 8.41E-08 mr1971_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251