Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620627981:

Variant ID: vg0620627981 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20627981
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGTACCGCCCCGGGTGGACCACTCGGTCGGGATGATCCGAGCGGTCGAACTTAATTGCTGTCTCTGACCACCGATATTGGGGCGTGTTAGGCTGAACC[G/A]
CATTGATCTCCCGTTCTGTTAGCTTCTGTTTTCTCTTGGACTCATAAGTCAGGGGTCCGCCGAAGATGTAATTAAGTTCTTTGCGATGATCTTGAAAACC

Reverse complement sequence

GGTTTTCAAGATCATCGCAAAGAACTTAATTACATCTTCGGCGGACCCCTGACTTATGAGTCCAAGAGAAAACAGAAGCTAACAGAACGGGAGATCAATG[C/T]
GGTTCAGCCTAACACGCCCCAATATCGGTGGTCAGAGACAGCAATTAAGTTCGACCGCTCGGATCATCCCGACCGAGTGGTCCACCCGGGGCGGTACCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	15.70%	0.30%	17.33%	66.74%	NA
All Indica	2759	1.00%	0.30%	18.30%	80.36%	NA
All Japonica	1512	45.80%	0.10%	15.61%	38.56%	NA
Aus	269	0.40%	0.00%	4.09%	95.54%	NA
Indica I	595	1.30%	0.80%	2.52%	95.29%	NA
Indica II	465	1.50%	0.40%	22.80%	75.27%	NA
Indica III	913	0.50%	0.10%	29.46%	69.88%	NA
Indica Intermediate	786	1.00%	0.10%	14.63%	84.22%	NA
Temperate Japonica	767	74.70%	0.10%	8.47%	16.69%	NA
Tropical Japonica	504	6.50%	0.00%	21.83%	71.63%	NA
Japonica Intermediate	241	35.70%	0.00%	25.31%	39.00%	NA
VI/Aromatic	96	0.00%	3.10%	48.96%	47.92%	NA
Intermediate	90	21.10%	0.00%	22.22%	56.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620627981	G -> A	LOC_Os06g35390.1	missense_variant ; p.Ala383Val; MODERATE	nonsynonymous_codon ; A383V	Average:14.85; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	benign	0.382	TOLERATED	0.07
vg0620627981	G -> DEL	LOC_Os06g35390.1	N	frameshift_variant	Average:14.85; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620627981	NA	1.13E-24	mr1020	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.24E-22	mr1021	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	8.75E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	8.45E-16	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.12E-10	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	5.23E-26	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	2.19E-28	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.01E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	4.17E-16	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	2.27E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.38E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	4.58E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.14E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	3.04E-23	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	3.42E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	9.26E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	5.56E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	5.85E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	5.44E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.15E-22	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	2.13E-44	mr1070_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.49E-31	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.67E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.88E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	9.05E-13	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	2.64E-14	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	1.23E-30	mr1477_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981	NA	2.71E-23	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251