\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620627981:

Variant ID: vg0620627981 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20627981
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGTACCGCCCCGGGTGGACCACTCGGTCGGGATGATCCGAGCGGTCGAACTTAATTGCTGTCTCTGACCACCGATATTGGGGCGTGTTAGGCTGAACC[G/A]
CATTGATCTCCCGTTCTGTTAGCTTCTGTTTTCTCTTGGACTCATAAGTCAGGGGTCCGCCGAAGATGTAATTAAGTTCTTTGCGATGATCTTGAAAACC

Reverse complement sequence

GGTTTTCAAGATCATCGCAAAGAACTTAATTACATCTTCGGCGGACCCCTGACTTATGAGTCCAAGAGAAAACAGAAGCTAACAGAACGGGAGATCAATG[C/T]
GGTTCAGCCTAACACGCCCCAATATCGGTGGTCAGAGACAGCAATTAAGTTCGACCGCTCGGATCATCCCGACCGAGTGGTCCACCCGGGGCGGTACCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 15.70% 0.30% 17.33% 66.74% NA
All Indica  2759 1.00% 0.30% 18.30% 80.36% NA
All Japonica  1512 45.80% 0.10% 15.61% 38.56% NA
Aus  269 0.40% 0.00% 4.09% 95.54% NA
Indica I  595 1.30% 0.80% 2.52% 95.29% NA
Indica II  465 1.50% 0.40% 22.80% 75.27% NA
Indica III  913 0.50% 0.10% 29.46% 69.88% NA
Indica Intermediate  786 1.00% 0.10% 14.63% 84.22% NA
Temperate Japonica  767 74.70% 0.10% 8.47% 16.69% NA
Tropical Japonica  504 6.50% 0.00% 21.83% 71.63% NA
Japonica Intermediate  241 35.70% 0.00% 25.31% 39.00% NA
VI/Aromatic  96 0.00% 3.10% 48.96% 47.92% NA
Intermediate  90 21.10% 0.00% 22.22% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620627981 G -> A LOC_Os06g35390.1 missense_variant ; p.Ala383Val; MODERATE nonsynonymous_codon ; A383V Average:14.85; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 benign 0.382 TOLERATED 0.07
vg0620627981 G -> DEL LOC_Os06g35390.1 N frameshift_variant Average:14.85; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620627981 NA 1.13E-24 mr1020 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.24E-22 mr1021 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 8.75E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 8.45E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.12E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 5.23E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 2.19E-28 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.01E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 4.17E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 2.27E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.38E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 4.58E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.14E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 3.04E-23 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 3.42E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 9.26E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 5.56E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 5.85E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 5.44E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.15E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 2.13E-44 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.49E-31 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.67E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.88E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 9.05E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 2.64E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 1.23E-30 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620627981 NA 2.71E-23 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251