Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620623481:

Variant ID: vg0620623481 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20623481
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGGCGTTTATGAGTTTGTGTCTGCTTCATGTTTGAAAGAGTTTTTTTTAAGTTTTCTATCGAAACAAGATTTCGGCAATAATAAAAGGGGGTGGCTAT[C/T]
AAGCTAGGAAAGTGGATGGGTTTGGAGACAAGGAATTTTATACAGGTTCAGGCCTTCTTATTCAAGAAGTAATACCCTACTCCTGTCCGGGGATGATTCC

Reverse complement sequence

GGAATCATCCCCGGACAGGAGTAGGGTATTACTTCTTGAATAAGAAGGCCTGAACCTGTATAAAATTCCTTGTCTCCAAACCCATCCACTTTCCTAGCTT[G/A]
ATAGCCACCCCCTTTTATTATTGCCGAAATCTTGTTTCGATAGAAAACTTAAAAAAAACTCTTTCAAACATGAAGCAGACACAAACTCATAAACGCCAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.90%	16.10%	0.00%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	52.80%	47.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	80.80%	19.20%	0.00%	0.00%	NA
Tropical Japonica	504	11.70%	88.30%	0.00%	0.00%	NA
Japonica Intermediate	241	49.40%	50.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620623481	C -> T	LOC_Os06g35360.1	upstream_gene_variant ; 3208.0bp to feature; MODIFIER	silent_mutation	Average:42.181; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0620623481	C -> T	LOC_Os06g35370.1	upstream_gene_variant ; 625.0bp to feature; MODIFIER	silent_mutation	Average:42.181; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0620623481	C -> T	LOC_Os06g35380.1	upstream_gene_variant ; 1408.0bp to feature; MODIFIER	silent_mutation	Average:42.181; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0620623481	C -> T	LOC_Os06g35390.1	downstream_gene_variant ; 3998.0bp to feature; MODIFIER	silent_mutation	Average:42.181; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0620623481	C -> T	LOC_Os06g35370-LOC_Os06g35380	intergenic_region ; MODIFIER	silent_mutation	Average:42.181; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620623481	5.73E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	1.27E-07	NA	mr1104	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	6.05E-07	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	8.74E-06	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	4.75E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	3.85E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	1.92E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	1.82E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	1.21E-12	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	4.59E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	1.10E-23	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	5.93E-06	mr1187_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	3.99E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	6.85E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	1.04E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	2.48E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	2.58E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	6.51E-14	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	1.26E-08	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	8.25E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	1.87E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	1.07E-22	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620623481	NA	2.50E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251