| Variant ID: vg0620620871 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20620871 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAGAAGGGGTATATAAAGCTGTGCAACTTTAGTCCCGGTTGGTAACACCAATCGGGCATAAAGATCTCAAATCACTTTAGTCCCGGTTGGTAACACGAA[C/T]
CGAGACTAAAGATCCCAAGCCCCCCGACAGAGGTCTGACATGCCCTGTCAGGAGGTGAACCGGGACTAAAGATGATCTTTAGTCCTGGTTGGTGTTACCA
TGGTAACACCAACCAGGACTAAAGATCATCTTTAGTCCCGGTTCACCTCCTGACAGGGCATGTCAGACCTCTGTCGGGGGGCTTGGGATCTTTAGTCTCG[G/A]
TTCGTGTTACCAACCGGGACTAAAGTGATTTGAGATCTTTATGCCCGATTGGTGTTACCAACCGGGACTAAAGTTGCACAGCTTTATATACCCCTTCTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 0.40% | 2.58% | 5.95% | NA |
| All Indica | 2759 | 87.30% | 0.10% | 3.37% | 9.24% | NA |
| All Japonica | 1512 | 96.60% | 1.10% | 1.32% | 0.99% | NA |
| Aus | 269 | 97.00% | 0.00% | 1.86% | 1.12% | NA |
| Indica I | 595 | 78.80% | 0.00% | 4.54% | 16.64% | NA |
| Indica II | 465 | 83.70% | 0.20% | 4.30% | 11.83% | NA |
| Indica III | 913 | 95.50% | 0.10% | 1.53% | 2.85% | NA |
| Indica Intermediate | 786 | 86.40% | 0.00% | 4.07% | 9.54% | NA |
| Temperate Japonica | 767 | 98.00% | 0.10% | 0.91% | 0.91% | NA |
| Tropical Japonica | 504 | 93.80% | 2.60% | 2.18% | 1.39% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 87.80% | 1.10% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620620871 | C -> T | LOC_Os06g35360.1 | upstream_gene_variant ; 598.0bp to feature; MODIFIER | silent_mutation | Average:49.772; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0620620871 | C -> T | LOC_Os06g35380.1 | upstream_gene_variant ; 4018.0bp to feature; MODIFIER | silent_mutation | Average:49.772; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0620620871 | C -> T | LOC_Os06g35370.1 | downstream_gene_variant ; 304.0bp to feature; MODIFIER | silent_mutation | Average:49.772; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0620620871 | C -> T | LOC_Os06g35360-LOC_Os06g35370 | intergenic_region ; MODIFIER | silent_mutation | Average:49.772; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0620620871 | C -> DEL | N | N | silent_mutation | Average:49.772; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620620871 | NA | 4.57E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620620871 | NA | 1.05E-07 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620620871 | NA | 2.80E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620620871 | NA | 6.58E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620620871 | NA | 8.36E-08 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620620871 | 1.11E-06 | 1.11E-06 | mr1663 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620620871 | NA | 1.08E-07 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |