Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0620613402:

Variant ID: vg0620613402 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20613402
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCGGGTTCATATGGGCGGGACCTTGACAGTGTAGACTTGGCAGCAAGTGCACGTGGAGGAGTAGTTGCCCGCGAGCCCGACGGTGCAGACTTGGCAGCT[G/A]
GTGCACGCGGAGGAGGTGGTGGTGCAGGGGAAGGAGCCAGAGGAGACTGACGAGGCGGTGATGGCGGAGGAGACTGTGCTTGCGGCGGGGAAGGAGGAGC

Reverse complement sequence

GCTCCTCCTTCCCCGCCGCAAGCACAGTCTCCTCCGCCATCACCGCCTCGTCAGTCTCCTCTGGCTCCTTCCCCTGCACCACCACCTCCTCCGCGTGCAC[C/T]
AGCTGCCAAGTCTGCACCGTCGGGCTCGCGGGCAACTACTCCTCCACGTGCACTTGCTGCCAAGTCTACACTGTCAAGGTCCCGCCCATATGAACCCGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 13.90% 0.85% 0.00% NA
All Indica  2759 98.90% 1.00% 0.07% 0.00% NA
All Japonica  1512 57.40% 40.20% 2.38% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 98.20% 1.70% 0.13% 0.00% NA
Temperate Japonica  767 82.40% 14.70% 2.87% 0.00% NA
Tropical Japonica  504 16.50% 81.70% 1.79% 0.00% NA
Japonica Intermediate  241 63.50% 34.40% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620613402 G -> A LOC_Os06g35350.1 missense_variant ; p.Pro463Leu; MODERATE nonsynonymous_codon ; P463L Average:53.984; most accessible tissue: Minghui63 young leaf, score: 77.243 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620613402 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620613402 NA 2.28E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 NA 2.17E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 NA 1.83E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 NA 4.12E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 NA 4.58E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 NA 7.64E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 NA 6.15E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 NA 7.72E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 3.28E-06 1.12E-09 mr1786_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 9.87E-07 7.29E-09 mr1786_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620613402 2.06E-06 5.36E-22 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251