Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620606045:

Variant ID: vg0620606045 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20606045
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, C: 0.17, others allele: 0.00, population size: 118. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTTTTCACGCCCATTTAGATAGGTATATACCTAACTAAAAATGGGTGTCCAAAATATGCAATTTTTAATGGGTATATACCTAAATCAATTCTGTTTA[T/C]
GGGTTATATTGTACTTAATTTTTCTCCGGTATATACTGATATTTTAGATAGTATATACTAGATTTTTCAAGTATCCAACATATATTAAATCAAACGGCTA

Reverse complement sequence

TAGCCGTTTGATTTAATATATGTTGGATACTTGAAAAATCTAGTATATACTATCTAAAATATCAGTATATACCGGAGAAAAATTAAGTACAATATAACCC[A/G]
TAAACAGAATTGATTTAGGTATATACCCATTAAAAATTGCATATTTTGGACACCCATTTTTAGTTAGGTATATACCTATCTAAATGGGCGTGAAAAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.50%	32.60%	1.23%	4.70%	NA
All Indica	2759	93.00%	2.20%	1.59%	3.23%	NA
All Japonica	1512	1.90%	91.70%	0.26%	6.22%	NA
Aus	269	97.00%	0.70%	1.49%	0.74%	NA
Indica I	595	91.30%	1.20%	2.86%	4.71%	NA
Indica II	465	91.00%	3.40%	1.94%	3.66%	NA
Indica III	913	95.60%	1.20%	0.44%	2.74%	NA
Indica Intermediate	786	92.50%	3.30%	1.78%	2.42%	NA
Temperate Japonica	767	1.20%	92.40%	0.00%	6.39%	NA
Tropical Japonica	504	2.80%	93.30%	0.20%	3.77%	NA
Japonica Intermediate	241	2.10%	85.90%	1.24%	10.79%	NA
VI/Aromatic	96	14.60%	53.10%	1.04%	31.25%	NA
Intermediate	90	40.00%	46.70%	5.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620606045	T -> C	LOC_Os06g35340.1	downstream_gene_variant ; 2703.0bp to feature; MODIFIER	silent_mutation	Average:33.153; most accessible tissue: Callus, score: 59.022	N	N	N	N
vg0620606045	T -> C	LOC_Os06g35340-LOC_Os06g35350	intergenic_region ; MODIFIER	silent_mutation	Average:33.153; most accessible tissue: Callus, score: 59.022	N	N	N	N
vg0620606045	T -> DEL	N	N	silent_mutation	Average:33.153; most accessible tissue: Callus, score: 59.022	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620606045	NA	1.72E-39	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	4.03E-48	mr1092	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	3.05E-11	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	7.31E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	7.99E-58	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	3.74E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	2.24E-45	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.40E-55	mr1154	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	2.27E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	6.70E-26	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	6.76E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.26E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	2.93E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.59E-26	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	4.90E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	4.90E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.40E-09	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	3.11E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	9.25E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.89E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	2.97E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.47E-26	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	9.42E-36	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	7.83E-44	mr1092_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	7.14E-13	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	9.66E-31	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.30E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	6.71E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	6.04E-43	mr1152_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	5.30E-53	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.83E-35	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.31E-22	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.36E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.55E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	1.42E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	7.62E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	8.39E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	2.82E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620606045	NA	3.80E-22	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251