\
| Variant ID: vg0620560057 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20560057 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, T: 0.01, others allele: 0.00, population size: 86. )
TATTATAAAAGTTGTCAAGATTGTCAGAAGTTTGGAGCAATCCAAAGGGCGCCGGCATCGGCTATGAATCCTATTATTAAACCGTGGCCTTTTAAAGGTT[G/A]
GGGAATTGATATGATCGGTATGATTAATCCACCCTCGAGTAAAAGACATAAGTTTATATTGGTGGCAACCGATTATTCTACCAAGTGGGTAGAGGCCATT
AATGGCCTCTACCCACTTGGTAGAATAATCGGTTGCCACCAATATAAACTTATGTCTTTTACTCGAGGGTGGATTAATCATACCGATCATATCAATTCCC[C/T]
AACCTTTAAAAGGCCACGGTTTAATAATAGGATTCATAGCCGATGCCGGCGCCCTTTGGATTGCTCCAAACTTCTGACAATCTTGACAACTTTTATAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.30% | 0.40% | 3.85% | 65.43% | NA |
| All Indica | 2759 | 6.00% | 0.60% | 1.56% | 91.84% | NA |
| All Japonica | 1512 | 60.60% | 0.00% | 7.14% | 32.21% | NA |
| Aus | 269 | 85.50% | 0.00% | 7.43% | 7.06% | NA |
| Indica I | 595 | 5.50% | 0.50% | 1.68% | 92.27% | NA |
| Indica II | 465 | 5.20% | 0.00% | 1.29% | 93.55% | NA |
| Indica III | 913 | 4.40% | 0.70% | 1.42% | 93.54% | NA |
| Indica Intermediate | 786 | 8.70% | 1.00% | 1.78% | 88.55% | NA |
| Temperate Japonica | 767 | 80.40% | 0.00% | 3.26% | 16.30% | NA |
| Tropical Japonica | 504 | 31.00% | 0.00% | 11.90% | 57.14% | NA |
| Japonica Intermediate | 241 | 59.80% | 0.00% | 9.54% | 30.71% | NA |
| VI/Aromatic | 96 | 88.50% | 1.00% | 7.29% | 3.12% | NA |
| Intermediate | 90 | 41.10% | 0.00% | 4.44% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620560057 | G -> A | LOC_Os06g35260.1 | stop_gained ; p.Trp244*; HIGH | stop_gained | Average:15.721; most accessible tissue: Minghui63 flower, score: 20.111 | N | N | N | N |
| vg0620560057 | G -> DEL | LOC_Os06g35260.1 | N | frameshift_variant | Average:15.721; most accessible tissue: Minghui63 flower, score: 20.111 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620560057 | NA | 1.15E-21 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 4.72E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 9.62E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 1.07E-12 | mr1335 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 3.71E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 5.24E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 2.13E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 2.60E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 1.03E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620560057 | NA | 1.10E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |