Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620558743:

Variant ID: vg0620558743 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20558743
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAGATGATCGGCAAAATTAATTTTGTTCGAAGGTTTATTTCTAATTTGTCTGGAAGACTGGAACCTTTTACACCATTGTTAAGATTGAGAGCCGATCA[G/A]
CAATTCACTTGGGGGGCAGAATAACAGAAAGCTTTGGATAATATTAAAGAATATTTAAGTTCTCCTCCAGTATTGATTCCTCCACAAAAAGGGATTCCTT

Reverse complement sequence

AAGGAATCCCTTTTTGTGGAGGAATCAATACTGGAGGAGAACTTAAATATTCTTTAATATTATCCAAAGCTTTCTGTTATTCTGCCCCCCAAGTGAATTG[C/T]
TGATCGGCTCTCAATCTTAACAATGGTGTAAAAGGTTCCAGTCTTCCAGACAAATTAGAAATAAACCTTCGAACAAAATTAATTTTGCCGATCATCTCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.70%	1.50%	1.18%	0.59%	NA
All Indica	2759	97.40%	0.10%	1.85%	0.72%	NA
All Japonica	1512	94.90%	4.40%	0.20%	0.53%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.30%	0.00%	3.19%	0.50%	NA
Indica II	465	97.20%	0.00%	1.72%	1.08%	NA
Indica III	913	98.20%	0.10%	0.88%	0.77%	NA
Indica Intermediate	786	97.20%	0.10%	2.04%	0.64%	NA
Temperate Japonica	767	94.10%	5.00%	0.26%	0.65%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	87.60%	11.60%	0.41%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620558743	G -> A	LOC_Os06g35240.1	upstream_gene_variant ; 3239.0bp to feature; MODIFIER	silent_mutation	Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0620558743	G -> A	LOC_Os06g35260.1	upstream_gene_variant ; 304.0bp to feature; MODIFIER	silent_mutation	Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0620558743	G -> A	LOC_Os06g35230.1	downstream_gene_variant ; 4878.0bp to feature; MODIFIER	silent_mutation	Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0620558743	G -> A	LOC_Os06g35250.1	downstream_gene_variant ; 99.0bp to feature; MODIFIER	silent_mutation	Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0620558743	G -> A	LOC_Os06g35270.1	downstream_gene_variant ; 2761.0bp to feature; MODIFIER	silent_mutation	Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0620558743	G -> A	LOC_Os06g35250-LOC_Os06g35260	intergenic_region ; MODIFIER	silent_mutation	Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0620558743	G -> DEL	N	N	silent_mutation	Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620558743	1.93E-07	NA	mr1024_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743	2.79E-06	2.79E-06	mr1024_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743	8.74E-07	3.33E-07	mr1037_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743	NA	4.47E-06	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743	6.35E-06	6.35E-06	mr1367_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743	NA	1.65E-06	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743	NA	8.29E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743	NA	2.56E-07	mr1827_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251