\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620558743:

Variant ID: vg0620558743 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20558743
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAGATGATCGGCAAAATTAATTTTGTTCGAAGGTTTATTTCTAATTTGTCTGGAAGACTGGAACCTTTTACACCATTGTTAAGATTGAGAGCCGATCA[G/A]
CAATTCACTTGGGGGGCAGAATAACAGAAAGCTTTGGATAATATTAAAGAATATTTAAGTTCTCCTCCAGTATTGATTCCTCCACAAAAAGGGATTCCTT

Reverse complement sequence

AAGGAATCCCTTTTTGTGGAGGAATCAATACTGGAGGAGAACTTAAATATTCTTTAATATTATCCAAAGCTTTCTGTTATTCTGCCCCCCAAGTGAATTG[C/T]
TGATCGGCTCTCAATCTTAACAATGGTGTAAAAGGTTCCAGTCTTCCAGACAAATTAGAAATAAACCTTCGAACAAAATTAATTTTGCCGATCATCTCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 1.50% 1.18% 0.59% NA
All Indica  2759 97.40% 0.10% 1.85% 0.72% NA
All Japonica  1512 94.90% 4.40% 0.20% 0.53% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.30% 0.00% 3.19% 0.50% NA
Indica II  465 97.20% 0.00% 1.72% 1.08% NA
Indica III  913 98.20% 0.10% 0.88% 0.77% NA
Indica Intermediate  786 97.20% 0.10% 2.04% 0.64% NA
Temperate Japonica  767 94.10% 5.00% 0.26% 0.65% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 87.60% 11.60% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620558743 G -> A LOC_Os06g35240.1 upstream_gene_variant ; 3239.0bp to feature; MODIFIER silent_mutation Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0620558743 G -> A LOC_Os06g35260.1 upstream_gene_variant ; 304.0bp to feature; MODIFIER silent_mutation Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0620558743 G -> A LOC_Os06g35230.1 downstream_gene_variant ; 4878.0bp to feature; MODIFIER silent_mutation Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0620558743 G -> A LOC_Os06g35250.1 downstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0620558743 G -> A LOC_Os06g35270.1 downstream_gene_variant ; 2761.0bp to feature; MODIFIER silent_mutation Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0620558743 G -> A LOC_Os06g35250-LOC_Os06g35260 intergenic_region ; MODIFIER silent_mutation Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0620558743 G -> DEL N N silent_mutation Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620558743 1.93E-07 NA mr1024_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743 2.79E-06 2.79E-06 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743 8.74E-07 3.33E-07 mr1037_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743 NA 4.47E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743 6.35E-06 6.35E-06 mr1367_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743 NA 1.65E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743 NA 8.29E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620558743 NA 2.56E-07 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251