\
| Variant ID: vg0620558743 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20558743 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 304. )
AGGAGATGATCGGCAAAATTAATTTTGTTCGAAGGTTTATTTCTAATTTGTCTGGAAGACTGGAACCTTTTACACCATTGTTAAGATTGAGAGCCGATCA[G/A]
CAATTCACTTGGGGGGCAGAATAACAGAAAGCTTTGGATAATATTAAAGAATATTTAAGTTCTCCTCCAGTATTGATTCCTCCACAAAAAGGGATTCCTT
AAGGAATCCCTTTTTGTGGAGGAATCAATACTGGAGGAGAACTTAAATATTCTTTAATATTATCCAAAGCTTTCTGTTATTCTGCCCCCCAAGTGAATTG[C/T]
TGATCGGCTCTCAATCTTAACAATGGTGTAAAAGGTTCCAGTCTTCCAGACAAATTAGAAATAAACCTTCGAACAAAATTAATTTTGCCGATCATCTCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 1.50% | 1.18% | 0.59% | NA |
| All Indica | 2759 | 97.40% | 0.10% | 1.85% | 0.72% | NA |
| All Japonica | 1512 | 94.90% | 4.40% | 0.20% | 0.53% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 0.00% | 3.19% | 0.50% | NA |
| Indica II | 465 | 97.20% | 0.00% | 1.72% | 1.08% | NA |
| Indica III | 913 | 98.20% | 0.10% | 0.88% | 0.77% | NA |
| Indica Intermediate | 786 | 97.20% | 0.10% | 2.04% | 0.64% | NA |
| Temperate Japonica | 767 | 94.10% | 5.00% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 87.60% | 11.60% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620558743 | G -> A | LOC_Os06g35240.1 | upstream_gene_variant ; 3239.0bp to feature; MODIFIER | silent_mutation | Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0620558743 | G -> A | LOC_Os06g35260.1 | upstream_gene_variant ; 304.0bp to feature; MODIFIER | silent_mutation | Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0620558743 | G -> A | LOC_Os06g35230.1 | downstream_gene_variant ; 4878.0bp to feature; MODIFIER | silent_mutation | Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0620558743 | G -> A | LOC_Os06g35250.1 | downstream_gene_variant ; 99.0bp to feature; MODIFIER | silent_mutation | Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0620558743 | G -> A | LOC_Os06g35270.1 | downstream_gene_variant ; 2761.0bp to feature; MODIFIER | silent_mutation | Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0620558743 | G -> A | LOC_Os06g35250-LOC_Os06g35260 | intergenic_region ; MODIFIER | silent_mutation | Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0620558743 | G -> DEL | N | N | silent_mutation | Average:23.558; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620558743 | 1.93E-07 | NA | mr1024_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620558743 | 2.79E-06 | 2.79E-06 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620558743 | 8.74E-07 | 3.33E-07 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620558743 | NA | 4.47E-06 | mr1291_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620558743 | 6.35E-06 | 6.35E-06 | mr1367_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620558743 | NA | 1.65E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620558743 | NA | 8.29E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620558743 | NA | 2.56E-07 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |