\
| Variant ID: vg0620515026 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20515026 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATCTATACAAGAATGCACCAAACGGGGTACTCCTAAAATGCGTCTTGTCCGACGACGGCAGACACCTCCTCCTCGACATACATGAAGGCATCTATGGGT[T/C]
ACATGCCGCCGGTTAGACATTAGTTGGAAAAGCTTTTCGACAAGGGTTCTTCTGGCCAACCGCCTTCAAAGACGCCTGTGACATGGTTCAGCGGTGTGAA
TTCACACCGCTGAACCATGTCACAGGCGTCTTTGAAGGCGGTTGGCCAGAAGAACCCTTGTCGAAAAGCTTTTCCAACTAATGTCTAACCGGCGGCATGT[A/G]
ACCCATAGATGCCTTCATGTATGTCGAGGAGGAGGTGTCTGCCGTCGTCGGACAAGACGCATTTTAGGAGTACCCCGTTTGGTGCATTCTTGTATAGATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.80% | 1.60% | 19.38% | 46.19% | NA |
| All Indica | 2759 | 7.10% | 0.10% | 22.69% | 70.13% | NA |
| All Japonica | 1512 | 85.50% | 4.40% | 1.92% | 8.13% | NA |
| Aus | 269 | 0.70% | 0.00% | 81.04% | 18.22% | NA |
| Indica I | 595 | 7.40% | 0.00% | 6.22% | 86.39% | NA |
| Indica II | 465 | 9.70% | 0.00% | 21.29% | 69.03% | NA |
| Indica III | 913 | 4.40% | 0.00% | 35.71% | 59.91% | NA |
| Indica Intermediate | 786 | 8.50% | 0.30% | 20.87% | 70.36% | NA |
| Temperate Japonica | 767 | 91.30% | 5.00% | 1.04% | 2.74% | NA |
| Tropical Japonica | 504 | 91.30% | 0.00% | 3.57% | 5.16% | NA |
| Japonica Intermediate | 241 | 55.20% | 12.00% | 1.24% | 31.54% | NA |
| VI/Aromatic | 96 | 19.80% | 1.00% | 32.29% | 46.88% | NA |
| Intermediate | 90 | 46.70% | 5.60% | 13.33% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620515026 | T -> C | LOC_Os06g35180.1 | missense_variant ; p.Leu654Ser; MODERATE | nonsynonymous_codon ; L654S | Average:12.64; most accessible tissue: Callus, score: 20.152 | unknown | unknown | TOLERATED | 1.00 |
| vg0620515026 | T -> DEL | LOC_Os06g35180.1 | N | frameshift_variant | Average:12.64; most accessible tissue: Callus, score: 20.152 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620515026 | 5.02E-07 | 6.11E-08 | mr1415 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620515026 | 5.02E-07 | 6.11E-08 | mr1567 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620515026 | 1.04E-06 | 7.69E-07 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620515026 | 1.31E-06 | 1.31E-06 | mr1281_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620515026 | 6.29E-06 | 6.29E-06 | mr1367_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620515026 | NA | 7.95E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620515026 | NA | 3.22E-07 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |