\
| Variant ID: vg0620514657 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20514657 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCGCAGAAGTCAGGAAGCTGGAAAAAAAGGTTTGATAGGATCGAGGTCCGACATGTATACCCCAAAGACAACATCGAACCGGATGATCTAGCACGGCGTG[T/C]
GTCCAGACGAGAGCCACTTGAACCTGGCACCTTTCTGGACGTCTTGACCAGACCATTAGTGAAAGAGGCAAGCGGCGAAGATAGCCCGGTCACCCACAAC
GTTGTGGGTGACCGGGCTATCTTCGCCGCTTGCCTCTTTCACTAATGGTCTGGTCAAGACGTCCAGAAAGGTGCCAGGTTCAAGTGGCTCTCGTCTGGAC[A/G]
CACGCCGTGCTAGATCATCCGGTTCGATGTTGTCTTTGGGGTATACATGTCGGACCTCGATCCTATCAAACCTTTTTTTCCAGCTTCCTGACTTCTGCGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.20% | 2.10% | 22.83% | 23.91% | NA |
| All Indica | 2759 | 37.60% | 0.30% | 28.49% | 33.64% | NA |
| All Japonica | 1512 | 85.80% | 4.80% | 1.92% | 7.41% | NA |
| Aus | 269 | 3.70% | 0.70% | 77.32% | 18.22% | NA |
| Indica I | 595 | 29.60% | 0.00% | 29.41% | 41.01% | NA |
| Indica II | 465 | 45.40% | 0.60% | 25.81% | 28.17% | NA |
| Indica III | 913 | 37.30% | 0.40% | 28.70% | 33.52% | NA |
| Indica Intermediate | 786 | 39.40% | 0.00% | 29.13% | 31.42% | NA |
| Temperate Japonica | 767 | 91.50% | 5.10% | 0.52% | 2.87% | NA |
| Tropical Japonica | 504 | 91.50% | 1.00% | 3.97% | 3.57% | NA |
| Japonica Intermediate | 241 | 56.00% | 12.00% | 2.07% | 29.88% | NA |
| VI/Aromatic | 96 | 17.70% | 13.50% | 42.71% | 26.04% | NA |
| Intermediate | 90 | 61.10% | 4.40% | 16.67% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620514657 | T -> C | LOC_Os06g35190.1 | downstream_gene_variant ; 2002.0bp to feature; MODIFIER | silent_mutation | Average:8.618; most accessible tissue: Callus, score: 19.455 | N | N | N | N |
| vg0620514657 | T -> C | LOC_Os06g35180.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.618; most accessible tissue: Callus, score: 19.455 | N | N | N | N |
| vg0620514657 | T -> DEL | N | N | silent_mutation | Average:8.618; most accessible tissue: Callus, score: 19.455 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620514657 | 6.28E-06 | 1.68E-06 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | 6.28E-06 | 1.68E-06 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | 1.84E-06 | 4.81E-07 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | 3.93E-06 | 3.93E-06 | mr1168_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | 2.33E-07 | 2.33E-07 | mr1367_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | NA | 9.01E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | NA | 7.73E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | NA | 9.10E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | NA | 8.42E-06 | mr1591_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | NA | 3.95E-06 | mr1726_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | 1.34E-06 | 1.34E-06 | mr1806_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514657 | NA | 7.96E-08 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |