Search for Variation information by Variation ID:
Detailed information for vg0620514412:
| Variant ID: vg0620514412 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20514412 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CAACAGCCAAGGAGCAGGGGCAGGATTCATCTTGACATCACCTTCGGGAGATCAATTCAAGCAAGCAATTCACCTCAACTTCAGGGCGACCAATAACACA[A/G]
CCGAGTACGAAGGACTACTCGCCGAGATAAGAGCTGCAGCTGCACTCGGAGTTAGGCGACTAATTCTGAAAGGGGATTCCGAACTAGTCGCGAACCAGGT
Reverse complement sequence
ACCTGGTTCGCGACTAGTTCGGAATCCCCTTTCAGAATTAGTCGCCTAACTCCGAGTGCAGCTGCAGCTCTTATCTCGGCGAGTAGTCCTTCGTACTCGG[T/C]
TGTGTTATTGGTCGCCCTGAAGTTGAGGTGAATTGCTTGCTTGAATTGATCTCCCGAAGGTGATGTCAAGATGAATCCTGCCCCTGCTCCTTGGCTGTTG
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.50% | 1.60% | 28.57% | 26.34% | NA |
| All Indica | 2759 | 24.70% | 0.00% | 38.02% | 37.22% | NA |
| All Japonica | 1512 | 85.40% | 4.60% | 1.92% | 8.07% | NA |
| Aus | 269 | 2.60% | 0.00% | 77.70% | 19.70% | NA |
| Indica I | 595 | 30.10% | 0.00% | 23.87% | 46.05% | NA |
| Indica II | 465 | 20.40% | 0.00% | 36.34% | 43.23% | NA |
| Indica III | 913 | 21.70% | 0.10% | 48.74% | 29.46% | NA |
| Indica Intermediate | 786 | 26.70% | 0.00% | 37.28% | 36.01% | NA |
| Temperate Japonica | 767 | 91.10% | 5.10% | 0.26% | 3.52% | NA |
| Tropical Japonica | 504 | 91.10% | 0.00% | 4.76% | 4.17% | NA |
| Japonica Intermediate | 241 | 55.60% | 12.40% | 1.24% | 30.71% | NA |
| VI/Aromatic | 96 | 26.00% | 1.00% | 47.92% | 25.00% | NA |
| Intermediate | 90 | 56.70% | 3.30% | 18.89% | 21.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620514412 | A -> G | LOC_Os06g35180.1 | missense_variant ; p.Thr502Ala; MODERATE | nonsynonymous_codon ; T502A | Average:7.219; most accessible tissue: Callus, score: 17.076 | benign  |
-0.461 |
TOLERATED | 1.00 |
| vg0620514412 | A -> DEL | LOC_Os06g35180.1 | N | frameshift_variant | Average:7.219; most accessible tissue: Callus, score: 17.076 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620514412 | 2.06E-06 | 2.06E-06 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514412 | NA | 3.10E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514412 | NA | 4.58E-06 | mr1291_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514412 | 9.14E-08 | 9.14E-08 | mr1367_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514412 | NA | 3.07E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514412 | 8.38E-06 | 1.08E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514412 | NA | 2.88E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514412 | NA | 1.63E-08 | mr1827_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620514412 | 3.93E-06 | 3.93E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |